FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631639_at:

>probe:Drosophila_2:1631639_at:72:319; Interrogation_Position=111; Antisense; GCCGTTCTGCAGAAGGCATTCAACA
>probe:Drosophila_2:1631639_at:297:717; Interrogation_Position=138; Antisense; TTCGACCACCAGAAGACCGGCAGTA
>probe:Drosophila_2:1631639_at:684:393; Interrogation_Position=171; Antisense; GAAATGGTGGCCGATATCCTCCGTC
>probe:Drosophila_2:1631639_at:491:455; Interrogation_Position=183; Antisense; GATATCCTCCGTCTTATGGGTCAGC
>probe:Drosophila_2:1631639_at:46:401; Interrogation_Position=213; Antisense; GACAGGCAGATCCTTGACGAGCTGA
>probe:Drosophila_2:1631639_at:727:73; Interrogation_Position=253; Antisense; AGGACAAATCCGGTCGCCTGGAGTT
>probe:Drosophila_2:1631639_at:485:707; Interrogation_Position=29; Antisense; TTAGCGGTGATCGATCTGGTGAACA
>probe:Drosophila_2:1631639_at:515:293; Interrogation_Position=350; Antisense; CGAGGCTTTCCGTCTGTACGACAAG
>probe:Drosophila_2:1631639_at:616:385; Interrogation_Position=444; Antisense; GAACAGGAGCTCGACATCATGATTG
>probe:Drosophila_2:1631639_at:693:73; Interrogation_Position=469; Antisense; AGGAAATCGATTCCGACGGCTCTGG
>probe:Drosophila_2:1631639_at:480:337; Interrogation_Position=487; Antisense; GCTCTGGCACCGTTGATTTTGATGA
>probe:Drosophila_2:1631639_at:527:141; Interrogation_Position=528; Antisense; ACTGGCGAGTAAGCATTGTGGACCC
>probe:Drosophila_2:1631639_at:708:723; Interrogation_Position=543; Antisense; TTGTGGACCCAACGTATCTCATAAT
>probe:Drosophila_2:1631639_at:438:31; Interrogation_Position=76; Antisense; ATAACATTGACGAAGACCTGACCCC

Paste this into a BLAST search page for me
GCCGTTCTGCAGAAGGCATTCAACATTCGACCACCAGAAGACCGGCAGTAGAAATGGTGGCCGATATCCTCCGTCGATATCCTCCGTCTTATGGGTCAGCGACAGGCAGATCCTTGACGAGCTGAAGGACAAATCCGGTCGCCTGGAGTTTTAGCGGTGATCGATCTGGTGAACACGAGGCTTTCCGTCTGTACGACAAGGAACAGGAGCTCGACATCATGATTGAGGAAATCGATTCCGACGGCTCTGGGCTCTGGCACCGTTGATTTTGATGAACTGGCGAGTAAGCATTGTGGACCCTTGTGGACCCAACGTATCTCATAATATAACATTGACGAAGACCTGACCCC

Full Affymetrix probeset data:

Annotations for 1631639_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720