Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631640_a_at:

>probe:Drosophila_2:1631640_a_at:206:607; Interrogation_Position=1046; Antisense; TGATGGAGGACGACTCTCACTCGCA
>probe:Drosophila_2:1631640_a_at:40:509; Interrogation_Position=1089; Antisense; GTGCGTGCCCATGGAGTACACAAGT
>probe:Drosophila_2:1631640_a_at:206:721; Interrogation_Position=632; Antisense; TTGCCGGCGGATCGCAAACATCCAA
>probe:Drosophila_2:1631640_a_at:75:179; Interrogation_Position=647; Antisense; AAACATCCAAGGACGCCATTCGGCG
>probe:Drosophila_2:1631640_a_at:535:315; Interrogation_Position=661; Antisense; GCCATTCGGCGCAAGCACAAAGACA
>probe:Drosophila_2:1631640_a_at:623:267; Interrogation_Position=695; Antisense; CAGGAATTCCAGGTGTGCCTCCGCA
>probe:Drosophila_2:1631640_a_at:667:573; Interrogation_Position=733; Antisense; GGCGCCCCACGAGGTCGAAGACGAA
>probe:Drosophila_2:1631640_a_at:132:235; Interrogation_Position=759; Antisense; AATCCTAACCGGAATGTTGCCCGCG
>probe:Drosophila_2:1631640_a_at:482:231; Interrogation_Position=771; Antisense; AATGTTGCCCGCGAACCATGGAATC
>probe:Drosophila_2:1631640_a_at:656:103; Interrogation_Position=863; Antisense; AGACTGCTCCGAAGGATGTGTCGCC
>probe:Drosophila_2:1631640_a_at:195:413; Interrogation_Position=932; Antisense; GACCGACGCCGTTGGAGCTATTGAG
>probe:Drosophila_2:1631640_a_at:426:5; Interrogation_Position=951; Antisense; ATTGAGTCCGGAATGCACTTCGGCC
>probe:Drosophila_2:1631640_a_at:55:507; Interrogation_Position=979; Antisense; GTGCCCACAACGATGCTCAGCGATG
>probe:Drosophila_2:1631640_a_at:138:281; Interrogation_Position=994; Antisense; CTCAGCGATGAAAGCCCCTCTAAGT

Paste this into a BLAST search page for me
TGATGGAGGACGACTCTCACTCGCAGTGCGTGCCCATGGAGTACACAAGTTTGCCGGCGGATCGCAAACATCCAAAAACATCCAAGGACGCCATTCGGCGGCCATTCGGCGCAAGCACAAAGACACAGGAATTCCAGGTGTGCCTCCGCAGGCGCCCCACGAGGTCGAAGACGAAAATCCTAACCGGAATGTTGCCCGCGAATGTTGCCCGCGAACCATGGAATCAGACTGCTCCGAAGGATGTGTCGCCGACCGACGCCGTTGGAGCTATTGAGATTGAGTCCGGAATGCACTTCGGCCGTGCCCACAACGATGCTCAGCGATGCTCAGCGATGAAAGCCCCTCTAAGT

Full Affymetrix probeset data:

Annotations for 1631640_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime