FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631642_at:

>probe:Drosophila_2:1631642_at:566:13; Interrogation_Position=1009; Antisense; ATTCACAATCTCGTGGCGCATCTGC
>probe:Drosophila_2:1631642_at:371:663; Interrogation_Position=1049; Antisense; TAAATGATCCACGACTGACTGCCTA
>probe:Drosophila_2:1631642_at:673:405; Interrogation_Position=1061; Antisense; GACTGACTGCCTATCTAAGTACCTT
>probe:Drosophila_2:1631642_at:692:449; Interrogation_Position=1134; Antisense; GATCGCGACATTTTACCTTTGCTTA
>probe:Drosophila_2:1631642_at:186:333; Interrogation_Position=681; Antisense; GCTGGACACCCACATGCGAAGGCAT
>probe:Drosophila_2:1631642_at:488:55; Interrogation_Position=710; Antisense; ATGAGCGGCCTTACGAGTGCGAGAT
>probe:Drosophila_2:1631642_at:139:529; Interrogation_Position=792; Antisense; GGGAGCTAAACCATATACCTGCCAA
>probe:Drosophila_2:1631642_at:232:21; Interrogation_Position=816; Antisense; ATATTGCCAACGCAACTTCGCGGAT
>probe:Drosophila_2:1631642_at:578:43; Interrogation_Position=839; Antisense; ATCGCACTTCCCTAGTTAAGCATGA
>probe:Drosophila_2:1631642_at:389:381; Interrogation_Position=866; Antisense; GAACCCATCGAAATGAGCGTCCTTA
>probe:Drosophila_2:1631642_at:37:277; Interrogation_Position=887; Antisense; CTTATGCCTGCAAGACCTGCGGAAA
>probe:Drosophila_2:1631642_at:430:217; Interrogation_Position=913; Antisense; AAGTTCACATATGCCAGTGTCCTTA
>probe:Drosophila_2:1631642_at:53:55; Interrogation_Position=940; Antisense; ATGCACTACAAGACGCACACGGGCG
>probe:Drosophila_2:1631642_at:524:183; Interrogation_Position=994; Antisense; AAAAGCTTCGCTCGCATTCACAATC

Paste this into a BLAST search page for me
ATTCACAATCTCGTGGCGCATCTGCTAAATGATCCACGACTGACTGCCTAGACTGACTGCCTATCTAAGTACCTTGATCGCGACATTTTACCTTTGCTTAGCTGGACACCCACATGCGAAGGCATATGAGCGGCCTTACGAGTGCGAGATGGGAGCTAAACCATATACCTGCCAAATATTGCCAACGCAACTTCGCGGATATCGCACTTCCCTAGTTAAGCATGAGAACCCATCGAAATGAGCGTCCTTACTTATGCCTGCAAGACCTGCGGAAAAAGTTCACATATGCCAGTGTCCTTAATGCACTACAAGACGCACACGGGCGAAAAGCTTCGCTCGCATTCACAATC

Full Affymetrix probeset data:

Annotations for 1631642_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720