FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631644_at:

>probe:Drosophila_2:1631644_at:639:21; Interrogation_Position=371; Antisense; ATAGGAGATCCCAGCCTGATGACCT
>probe:Drosophila_2:1631644_at:250:445; Interrogation_Position=388; Antisense; GATGACCTACGTTAAGCTGGACCCC
>probe:Drosophila_2:1631644_at:453:587; Interrogation_Position=405; Antisense; TGGACCCCACTTTTGACATCGTAGG
>probe:Drosophila_2:1631644_at:598:483; Interrogation_Position=444; Antisense; GTATCAGCCGCCCTGAAGTGGTCAA
>probe:Drosophila_2:1631644_at:685:573; Interrogation_Position=486; Antisense; GGCTGGCAGCCATTGTGTTTATTAT
>probe:Drosophila_2:1631644_at:91:189; Interrogation_Position=511; Antisense; AACAGAGGAGTGTGCCATTTGCCCA
>probe:Drosophila_2:1631644_at:164:397; Interrogation_Position=556; Antisense; GACCGATGGTCGTGTTATACCCAAC
>probe:Drosophila_2:1631644_at:224:239; Interrogation_Position=621; Antisense; AATCATATTACCAGCTCTATCGCCT
>probe:Drosophila_2:1631644_at:664:147; Interrogation_Position=693; Antisense; ACTATGCTATTGACTTTCTGGACAC
>probe:Drosophila_2:1631644_at:111:713; Interrogation_Position=708; Antisense; TTCTGGACACCATTGACTGCGTAAT
>probe:Drosophila_2:1631644_at:721:241; Interrogation_Position=730; Antisense; AATACCACTGTGTCAGGCTTTTGCC
>probe:Drosophila_2:1631644_at:268:653; Interrogation_Position=786; Antisense; TAATCAAGTCGTGCCTTTGGTTGGG
>probe:Drosophila_2:1631644_at:355:541; Interrogation_Position=804; Antisense; GGTTGGGCATGACATTCTTTCACAA
>probe:Drosophila_2:1631644_at:560:115; Interrogation_Position=843; Antisense; AGCATGGTTTCCTTTACTTGGGCGA

Paste this into a BLAST search page for me
ATAGGAGATCCCAGCCTGATGACCTGATGACCTACGTTAAGCTGGACCCCTGGACCCCACTTTTGACATCGTAGGGTATCAGCCGCCCTGAAGTGGTCAAGGCTGGCAGCCATTGTGTTTATTATAACAGAGGAGTGTGCCATTTGCCCAGACCGATGGTCGTGTTATACCCAACAATCATATTACCAGCTCTATCGCCTACTATGCTATTGACTTTCTGGACACTTCTGGACACCATTGACTGCGTAATAATACCACTGTGTCAGGCTTTTGCCTAATCAAGTCGTGCCTTTGGTTGGGGGTTGGGCATGACATTCTTTCACAAAGCATGGTTTCCTTTACTTGGGCGA

Full Affymetrix probeset data:

Annotations for 1631644_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720