FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631646_at:

>probe:Drosophila_2:1631646_at:182:7; Interrogation_Position=225; Antisense; ATTGCATGCACATCATTGGCAGAGC
>probe:Drosophila_2:1631646_at:385:133; Interrogation_Position=356; Antisense; ACCCACCTTGCCTGATCGATATTAA
>probe:Drosophila_2:1631646_at:181:659; Interrogation_Position=378; Antisense; TAAGCTGAAGTCAAGCCGATCGGCA
>probe:Drosophila_2:1631646_at:644:663; Interrogation_Position=420; Antisense; TACAACAACCGCCAATCAGCTGCAG
>probe:Drosophila_2:1631646_at:430:139; Interrogation_Position=550; Antisense; ACGGATGCCAGTGACCTGGCCAATA
>probe:Drosophila_2:1631646_at:277:581; Interrogation_Position=566; Antisense; TGGCCAATATGACATCACCGCTGAG
>probe:Drosophila_2:1631646_at:642:507; Interrogation_Position=596; Antisense; GTGCAGCGGCCACTCGAATCAACGG
>probe:Drosophila_2:1631646_at:401:365; Interrogation_Position=611; Antisense; GAATCAACGGCCTCTCGCCGGAAGT
>probe:Drosophila_2:1631646_at:469:371; Interrogation_Position=636; Antisense; GAAGAAAGTCCAGCGGTTGCCACTG
>probe:Drosophila_2:1631646_at:73:723; Interrogation_Position=652; Antisense; TTGCCACTGTGGAATGCGCGAAACG
>probe:Drosophila_2:1631646_at:668:321; Interrogation_Position=735; Antisense; GCCCATCCAAAGTCATCAGCAGCGA
>probe:Drosophila_2:1631646_at:16:265; Interrogation_Position=751; Antisense; CAGCAGCGAATTCTAAACCAACGAT
>probe:Drosophila_2:1631646_at:559:175; Interrogation_Position=765; Antisense; AAACCAACGATTTCATCACCAGCGA
>probe:Drosophila_2:1631646_at:564:33; Interrogation_Position=779; Antisense; ATCACCAGCGAATGCATCATGGGTA

Paste this into a BLAST search page for me
ATTGCATGCACATCATTGGCAGAGCACCCACCTTGCCTGATCGATATTAATAAGCTGAAGTCAAGCCGATCGGCATACAACAACCGCCAATCAGCTGCAGACGGATGCCAGTGACCTGGCCAATATGGCCAATATGACATCACCGCTGAGGTGCAGCGGCCACTCGAATCAACGGGAATCAACGGCCTCTCGCCGGAAGTGAAGAAAGTCCAGCGGTTGCCACTGTTGCCACTGTGGAATGCGCGAAACGGCCCATCCAAAGTCATCAGCAGCGACAGCAGCGAATTCTAAACCAACGATAAACCAACGATTTCATCACCAGCGAATCACCAGCGAATGCATCATGGGTA

Full Affymetrix probeset data:

Annotations for 1631646_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720