FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631648_at:

>probe:Drosophila_2:1631648_at:389:121; Interrogation_Position=268; Antisense; AGCGGAGAACATGCCGGATCTCAGA
>probe:Drosophila_2:1631648_at:241:191; Interrogation_Position=314; Antisense; AACTTGGTGGGACACATGGCGTCCA
>probe:Drosophila_2:1631648_at:138:399; Interrogation_Position=380; Antisense; GACACTTCTGCCCAGGAACAACAAC
>probe:Drosophila_2:1631648_at:203:57; Interrogation_Position=423; Antisense; ATGAGCATATGAATCGGCCACGAAT
>probe:Drosophila_2:1631648_at:220:231; Interrogation_Position=445; Antisense; AATGTTGTTGTTGCTTCGCCGGAGC
>probe:Drosophila_2:1631648_at:604:619; Interrogation_Position=477; Antisense; TGCTTGTGTGTGTGCCATCAACACC
>probe:Drosophila_2:1631648_at:558:655; Interrogation_Position=520; Antisense; TAAGCACCAAAAAAGCCGCCGAGTT
>probe:Drosophila_2:1631648_at:377:125; Interrogation_Position=533; Antisense; AGCCGCCGAGTTTTTGACATTCGAA
>probe:Drosophila_2:1631648_at:51:583; Interrogation_Position=560; Antisense; TGGCGATCAGAGTAGCTGCTGCATT
>probe:Drosophila_2:1631648_at:649:281; Interrogation_Position=575; Antisense; CTGCTGCATTTAGCCTGCTTTTAAA
>probe:Drosophila_2:1631648_at:80:169; Interrogation_Position=611; Antisense; AAATGTCTGCTCTGTACACGTTGCG
>probe:Drosophila_2:1631648_at:55:15; Interrogation_Position=665; Antisense; ATTACTTCTCTTCTGGTGGTCCAAA
>probe:Drosophila_2:1631648_at:171:263; Interrogation_Position=704; Antisense; CAGCGGCGGCGGTGCAAAATGTTTT
>probe:Drosophila_2:1631648_at:263:431; Interrogation_Position=766; Antisense; GAGTCAATCGGTCTTTCAACACATT

Paste this into a BLAST search page for me
AGCGGAGAACATGCCGGATCTCAGAAACTTGGTGGGACACATGGCGTCCAGACACTTCTGCCCAGGAACAACAACATGAGCATATGAATCGGCCACGAATAATGTTGTTGTTGCTTCGCCGGAGCTGCTTGTGTGTGTGCCATCAACACCTAAGCACCAAAAAAGCCGCCGAGTTAGCCGCCGAGTTTTTGACATTCGAATGGCGATCAGAGTAGCTGCTGCATTCTGCTGCATTTAGCCTGCTTTTAAAAAATGTCTGCTCTGTACACGTTGCGATTACTTCTCTTCTGGTGGTCCAAACAGCGGCGGCGGTGCAAAATGTTTTGAGTCAATCGGTCTTTCAACACATT

Full Affymetrix probeset data:

Annotations for 1631648_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720