Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631649_at:

>probe:Drosophila_2:1631649_at:420:231; Interrogation_Position=3334; Antisense; AATGATTCGGATTCGTTGGTTGCCC
>probe:Drosophila_2:1631649_at:489:725; Interrogation_Position=3349; Antisense; TTGGTTGCCCCATATGTTAATAGTG
>probe:Drosophila_2:1631649_at:106:147; Interrogation_Position=3392; Antisense; ACTAGTTGAGTTCCTGAGTTTCAGA
>probe:Drosophila_2:1631649_at:463:477; Interrogation_Position=3409; Antisense; GTTTCAGAGTTCGAATGCCTCACCG
>probe:Drosophila_2:1631649_at:178:627; Interrogation_Position=3424; Antisense; TGCCTCACCGATATTGCTGATTCTA
>probe:Drosophila_2:1631649_at:386:21; Interrogation_Position=3456; Antisense; CTATTACTACTATCCGTACGTTCTC
>probe:Drosophila_2:1631649_at:690:471; Interrogation_Position=3475; Antisense; GTTCTCATCCGTATCTTTGTATCTT
>probe:Drosophila_2:1631649_at:369:725; Interrogation_Position=3491; Antisense; TTGTATCTTAATCAATCCCCATGCC
>probe:Drosophila_2:1631649_at:343:235; Interrogation_Position=3527; Antisense; AATCGCTTGTTATCCTTCCGTTGAG
>probe:Drosophila_2:1631649_at:472:455; Interrogation_Position=3700; Antisense; GATAACTACGATCAATGCCCGACTA
>probe:Drosophila_2:1631649_at:541:65; Interrogation_Position=3736; Antisense; AGGCCGACTATAGTTGTAGGTTCGC
>probe:Drosophila_2:1631649_at:501:485; Interrogation_Position=3751; Antisense; GTAGGTTCGCACATCCATATCGGAA
>probe:Drosophila_2:1631649_at:516:423; Interrogation_Position=3835; Antisense; GAGAACATCACATTACATTACCCTA
>probe:Drosophila_2:1631649_at:513:93; Interrogation_Position=3870; Antisense; AGTTGTTGTGAGACATTTACCCATA

Paste this into a BLAST search page for me
AATGATTCGGATTCGTTGGTTGCCCTTGGTTGCCCCATATGTTAATAGTGACTAGTTGAGTTCCTGAGTTTCAGAGTTTCAGAGTTCGAATGCCTCACCGTGCCTCACCGATATTGCTGATTCTACTATTACTACTATCCGTACGTTCTCGTTCTCATCCGTATCTTTGTATCTTTTGTATCTTAATCAATCCCCATGCCAATCGCTTGTTATCCTTCCGTTGAGGATAACTACGATCAATGCCCGACTAAGGCCGACTATAGTTGTAGGTTCGCGTAGGTTCGCACATCCATATCGGAAGAGAACATCACATTACATTACCCTAAGTTGTTGTGAGACATTTACCCATA

Full Affymetrix probeset data:

Annotations for 1631649_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime