FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631651_at:

>probe:Drosophila_2:1631651_at:630:373; Interrogation_Position=1000; Antisense; GAAGTACTCAACGATTCCACTCAGG
>probe:Drosophila_2:1631651_at:202:413; Interrogation_Position=1086; Antisense; GACCGAGGCACTTGACTATCTAAAT
>probe:Drosophila_2:1631651_at:339:73; Interrogation_Position=1156; Antisense; AGGAAGCGAACCCTGAGCATCAGAT
>probe:Drosophila_2:1631651_at:695:675; Interrogation_Position=1181; Antisense; TAGAACAGCTTCTCAAGGGCATCGA
>probe:Drosophila_2:1631651_at:258:249; Interrogation_Position=1220; Antisense; AATTGGCCTGTGACGATGCTCCTAT
>probe:Drosophila_2:1631651_at:692:51; Interrogation_Position=1235; Antisense; ATGCTCCTATCCTTAATGTGCTCAG
>probe:Drosophila_2:1631651_at:87:49; Interrogation_Position=1250; Antisense; ATGTGCTCAGTACCAAAACCTTTTT
>probe:Drosophila_2:1631651_at:654:509; Interrogation_Position=1288; Antisense; GTGAAGCTTTTCATTGGCGTCATTG
>probe:Drosophila_2:1631651_at:564:707; Interrogation_Position=1310; Antisense; TTGAACGCCGGGTCAACCTGATCAT
>probe:Drosophila_2:1631651_at:608:453; Interrogation_Position=1329; Antisense; GATCATCAGCGCCATCAATATCGAG
>probe:Drosophila_2:1631651_at:143:565; Interrogation_Position=1373; Antisense; TGGCCCGAAAGGATCGTGTTCCCAA
>probe:Drosophila_2:1631651_at:658:421; Interrogation_Position=838; Antisense; GAGACCTACGAGAGGCAGCTTCTGG
>probe:Drosophila_2:1631651_at:156:375; Interrogation_Position=882; Antisense; GAAGATCAAGTTGCTCTACGGCGAG
>probe:Drosophila_2:1631651_at:14:593; Interrogation_Position=923; Antisense; TGGTGGCCCAGTTCAAGCGTCAGGA

Paste this into a BLAST search page for me
GAAGTACTCAACGATTCCACTCAGGGACCGAGGCACTTGACTATCTAAATAGGAAGCGAACCCTGAGCATCAGATTAGAACAGCTTCTCAAGGGCATCGAAATTGGCCTGTGACGATGCTCCTATATGCTCCTATCCTTAATGTGCTCAGATGTGCTCAGTACCAAAACCTTTTTGTGAAGCTTTTCATTGGCGTCATTGTTGAACGCCGGGTCAACCTGATCATGATCATCAGCGCCATCAATATCGAGTGGCCCGAAAGGATCGTGTTCCCAAGAGACCTACGAGAGGCAGCTTCTGGGAAGATCAAGTTGCTCTACGGCGAGTGGTGGCCCAGTTCAAGCGTCAGGA

Full Affymetrix probeset data:

Annotations for 1631651_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720