FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631652_at:

>probe:Drosophila_2:1631652_at:348:689; Interrogation_Position=211; Antisense; TATTCCCCGCTCTTTGAGACGGATA
>probe:Drosophila_2:1631652_at:1:545; Interrogation_Position=231; Antisense; GGATATACGTTCGTCGATGCCCGTG
>probe:Drosophila_2:1631652_at:196:569; Interrogation_Position=255; Antisense; GGCAGGTGGCTTCTTTATCATCTAC
>probe:Drosophila_2:1631652_at:310:685; Interrogation_Position=270; Antisense; TATCATCTACTTCCTGCTAATCATC
>probe:Drosophila_2:1631652_at:104:655; Interrogation_Position=287; Antisense; TAATCATCCTGTCTTCCTATTTGGT
>probe:Drosophila_2:1631652_at:349:133; Interrogation_Position=351; Antisense; ACCCTGGCTGGGTCTAATTGGACTA
>probe:Drosophila_2:1631652_at:62:249; Interrogation_Position=366; Antisense; AATTGGACTAGCCATTCTCTTCCAG
>probe:Drosophila_2:1631652_at:201:267; Interrogation_Position=388; Antisense; CAGTTTAGCTGGAGCCTTTGGCTTA
>probe:Drosophila_2:1631652_at:647:609; Interrogation_Position=458; Antisense; TGAACTTCGTTTGGGTAGCCTACAA
>probe:Drosophila_2:1631652_at:397:23; Interrogation_Position=482; Antisense; ATATCTATTGCTGGCTGGTGGTCTT
>probe:Drosophila_2:1631652_at:552:537; Interrogation_Position=501; Antisense; GGTCTTCTCGCAGTACCAGATATTC
>probe:Drosophila_2:1631652_at:271:111; Interrogation_Position=536; Antisense; AGAATCCGAACATTGAGCTGCTCAT
>probe:Drosophila_2:1631652_at:410:211; Interrogation_Position=632; Antisense; AAGAACTCCGTCCATGCGCATTTTT
>probe:Drosophila_2:1631652_at:649:29; Interrogation_Position=672; Antisense; ATACAATTCCACAGATGCCTACCAA

Paste this into a BLAST search page for me
TATTCCCCGCTCTTTGAGACGGATAGGATATACGTTCGTCGATGCCCGTGGGCAGGTGGCTTCTTTATCATCTACTATCATCTACTTCCTGCTAATCATCTAATCATCCTGTCTTCCTATTTGGTACCCTGGCTGGGTCTAATTGGACTAAATTGGACTAGCCATTCTCTTCCAGCAGTTTAGCTGGAGCCTTTGGCTTATGAACTTCGTTTGGGTAGCCTACAAATATCTATTGCTGGCTGGTGGTCTTGGTCTTCTCGCAGTACCAGATATTCAGAATCCGAACATTGAGCTGCTCATAAGAACTCCGTCCATGCGCATTTTTATACAATTCCACAGATGCCTACCAA

Full Affymetrix probeset data:

Annotations for 1631652_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720