FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631653_at:

>probe:Drosophila_2:1631653_at:42:363; Interrogation_Position=1022; Antisense; GAATAGTACCTCCTAACTGTATAAA
>probe:Drosophila_2:1631653_at:197:549; Interrogation_Position=543; Antisense; GGAGTCCCAACTTCACAAAATGCAG
>probe:Drosophila_2:1631653_at:385:255; Interrogation_Position=558; Antisense; CAAAATGCAGGCTCCTAGGGCCAAA
>probe:Drosophila_2:1631653_at:690:677; Interrogation_Position=573; Antisense; TAGGGCCAAACCGATTCCGCAGAGC
>probe:Drosophila_2:1631653_at:590:99; Interrogation_Position=593; Antisense; AGAGCAGCCGTCAGCCCTTGAAGTC
>probe:Drosophila_2:1631653_at:204:121; Interrogation_Position=701; Antisense; AGCGGCGCATTTTCAACATCCAGAC
>probe:Drosophila_2:1631653_at:613:189; Interrogation_Position=715; Antisense; AACATCCAGACGTCCAAGGCGCAGG
>probe:Drosophila_2:1631653_at:566:197; Interrogation_Position=782; Antisense; AACGGGAGGCCTACCAAAAGCTGCG
>probe:Drosophila_2:1631653_at:583:181; Interrogation_Position=797; Antisense; AAAAGCTGCGCCAACGAACCACGTT
>probe:Drosophila_2:1631653_at:151:231; Interrogation_Position=835; Antisense; AATCCATTTTCGCAGACCGCACGTT
>probe:Drosophila_2:1631653_at:487:543; Interrogation_Position=868; Antisense; GGATTTCCCTCTATTCTGGTTTTGC
>probe:Drosophila_2:1631653_at:70:689; Interrogation_Position=912; Antisense; TTTCGGGCTTTCATTTCGTTTGGAT
>probe:Drosophila_2:1631653_at:506:677; Interrogation_Position=977; Antisense; TATAATCACCAGCAGGCAACCGCAA
>probe:Drosophila_2:1631653_at:231:359; Interrogation_Position=998; Antisense; GCAAACTCACTGTGCGGGCTAAATG

Paste this into a BLAST search page for me
GAATAGTACCTCCTAACTGTATAAAGGAGTCCCAACTTCACAAAATGCAGCAAAATGCAGGCTCCTAGGGCCAAATAGGGCCAAACCGATTCCGCAGAGCAGAGCAGCCGTCAGCCCTTGAAGTCAGCGGCGCATTTTCAACATCCAGACAACATCCAGACGTCCAAGGCGCAGGAACGGGAGGCCTACCAAAAGCTGCGAAAAGCTGCGCCAACGAACCACGTTAATCCATTTTCGCAGACCGCACGTTGGATTTCCCTCTATTCTGGTTTTGCTTTCGGGCTTTCATTTCGTTTGGATTATAATCACCAGCAGGCAACCGCAAGCAAACTCACTGTGCGGGCTAAATG

Full Affymetrix probeset data:

Annotations for 1631653_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720