Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631654_at:

>probe:Drosophila_2:1631654_at:331:713; Interrogation_Position=1520; Antisense; TTCTTGCTCATTATCCTGGACGACA
>probe:Drosophila_2:1631654_at:595:585; Interrogation_Position=1580; Antisense; TGGACAATCCTCCTATTCATAGCAG
>probe:Drosophila_2:1631654_at:249:641; Interrogation_Position=1596; Antisense; TCATAGCAGCCCTTTTTGTTTTGTC
>probe:Drosophila_2:1631654_at:435:723; Interrogation_Position=1611; Antisense; TTGTTTTGTCTGAGGCCGTGGATCA
>probe:Drosophila_2:1631654_at:75:265; Interrogation_Position=1703; Antisense; CAGATTGCGGTAACCACCATGGTAA
>probe:Drosophila_2:1631654_at:590:589; Interrogation_Position=1722; Antisense; TGGTAATTCTATGGACGACCGCCCT
>probe:Drosophila_2:1631654_at:683:281; Interrogation_Position=1741; Antisense; CGCCCTACTTACAATCTTTATCGAC
>probe:Drosophila_2:1631654_at:37:635; Interrogation_Position=1761; Antisense; TCGACAACGCCGCTGTTACAATATT
>probe:Drosophila_2:1631654_at:224:261; Interrogation_Position=1836; Antisense; CACCGATGTTTTGGGCGTTGACTTT
>probe:Drosophila_2:1631654_at:678:427; Interrogation_Position=1910; Antisense; GAGATTATTGCGCTGATCGCCCTAC
>probe:Drosophila_2:1631654_at:152:449; Interrogation_Position=1924; Antisense; GATCGCCCTACAGCATGGCTATAAG
>probe:Drosophila_2:1631654_at:161:97; Interrogation_Position=1947; Antisense; AGATATCTTTCTGGCACTTTTTCGC
>probe:Drosophila_2:1631654_at:688:701; Interrogation_Position=1965; Antisense; TTTTCGCCATCGGATTTCCACTAAT
>probe:Drosophila_2:1631654_at:527:529; Interrogation_Position=2014; Antisense; GGGATACCTTTTAATCGCACACTCA

Paste this into a BLAST search page for me
TTCTTGCTCATTATCCTGGACGACATGGACAATCCTCCTATTCATAGCAGTCATAGCAGCCCTTTTTGTTTTGTCTTGTTTTGTCTGAGGCCGTGGATCACAGATTGCGGTAACCACCATGGTAATGGTAATTCTATGGACGACCGCCCTCGCCCTACTTACAATCTTTATCGACTCGACAACGCCGCTGTTACAATATTCACCGATGTTTTGGGCGTTGACTTTGAGATTATTGCGCTGATCGCCCTACGATCGCCCTACAGCATGGCTATAAGAGATATCTTTCTGGCACTTTTTCGCTTTTCGCCATCGGATTTCCACTAATGGGATACCTTTTAATCGCACACTCA

Full Affymetrix probeset data:

Annotations for 1631654_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime