FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631659_at:

>probe:Drosophila_2:1631659_at:533:81; Interrogation_Position=2279; Antisense; AGGGCAGTCATCTGGGCGACGAACT
>probe:Drosophila_2:1631659_at:540:405; Interrogation_Position=2296; Antisense; GACGAACTGAGCTACGCCATTTTGG
>probe:Drosophila_2:1631659_at:702:553; Interrogation_Position=2319; Antisense; GGAGCTGCAGAAGGATCGTTTCTTT
>probe:Drosophila_2:1631659_at:341:563; Interrogation_Position=2366; Antisense; GGAACCAATCGAATCTGCCTAACTG
>probe:Drosophila_2:1631659_at:155:73; Interrogation_Position=2408; Antisense; AGGAAGGCATCACCCTGGAGAGTTT
>probe:Drosophila_2:1631659_at:451:727; Interrogation_Position=2465; Antisense; TTGTCCTTGCCATGATGACTCTCGG
>probe:Drosophila_2:1631659_at:424:639; Interrogation_Position=2486; Antisense; TCGGCATGGAGGTGCTCTACTACAA
>probe:Drosophila_2:1631659_at:623:393; Interrogation_Position=2530; Antisense; GAAATAACCCAGGTGCGTCCGGTGA
>probe:Drosophila_2:1631659_at:431:529; Interrogation_Position=2566; Antisense; GGGTCCGGAGGCAATTCCTCAACAG
>probe:Drosophila_2:1631659_at:301:353; Interrogation_Position=2609; Antisense; GCACCACGAAGCAGGCATGGCACAT
>probe:Drosophila_2:1631659_at:679:623; Interrogation_Position=2683; Antisense; TCCTTCGAAACAGCCACATTCAGGG
>probe:Drosophila_2:1631659_at:400:267; Interrogation_Position=2724; Antisense; CAGGATCACTCTGGGCGATGGCAAA
>probe:Drosophila_2:1631659_at:58:19; Interrogation_Position=2748; Antisense; ATTTAAGCCGCGTCATGGACTGTAC
>probe:Drosophila_2:1631659_at:154:223; Interrogation_Position=2775; Antisense; AAGGAGGAATCTCGGTGCCTCTGAC

Paste this into a BLAST search page for me
AGGGCAGTCATCTGGGCGACGAACTGACGAACTGAGCTACGCCATTTTGGGGAGCTGCAGAAGGATCGTTTCTTTGGAACCAATCGAATCTGCCTAACTGAGGAAGGCATCACCCTGGAGAGTTTTTGTCCTTGCCATGATGACTCTCGGTCGGCATGGAGGTGCTCTACTACAAGAAATAACCCAGGTGCGTCCGGTGAGGGTCCGGAGGCAATTCCTCAACAGGCACCACGAAGCAGGCATGGCACATTCCTTCGAAACAGCCACATTCAGGGCAGGATCACTCTGGGCGATGGCAAAATTTAAGCCGCGTCATGGACTGTACAAGGAGGAATCTCGGTGCCTCTGAC

Full Affymetrix probeset data:

Annotations for 1631659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720