Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631660_at:

>probe:Drosophila_2:1631660_at:298:473; Interrogation_Position=103; Antisense; GTTAAATCCGGGTAATGTCATTATC
>probe:Drosophila_2:1631660_at:104:497; Interrogation_Position=119; Antisense; GTCATTATCAATGGAGATTGCCGTC
>probe:Drosophila_2:1631660_at:690:585; Interrogation_Position=130; Antisense; TGGAGATTGCCGTCATTGTAATGTT
>probe:Drosophila_2:1631660_at:101:35; Interrogation_Position=14; Antisense; ATCAGTTTCATTTCAACCGTTGCCA
>probe:Drosophila_2:1631660_at:475:497; Interrogation_Position=141; Antisense; GTCATTGTAATGTTCGCGGAGGCTA
>probe:Drosophila_2:1631660_at:99:471; Interrogation_Position=152; Antisense; GTTCGCGGAGGCTAAATTGGAGTTA
>probe:Drosophila_2:1631660_at:702:191; Interrogation_Position=180; Antisense; AACTTTGATGTTTAGTAACTACAAT
>probe:Drosophila_2:1631660_at:489:199; Interrogation_Position=28; Antisense; AACCGTTGCCAACAATATGAAGTGG
>probe:Drosophila_2:1631660_at:102:221; Interrogation_Position=47; Antisense; AAGTGGATGTCCTTGGTCTTTCTAT
>probe:Drosophila_2:1631660_at:723:59; Interrogation_Position=53; Antisense; ATGTCCTTGGTCTTTCTATGCGGTC
>probe:Drosophila_2:1631660_at:615:729; Interrogation_Position=59; Antisense; TTGGTCTTTCTATGCGGTCTGCTCG
>probe:Drosophila_2:1631660_at:480:681; Interrogation_Position=69; Antisense; TATGCGGTCTGCTCGCCATGGCAGT
>probe:Drosophila_2:1631660_at:496:67; Interrogation_Position=86; Antisense; ATGGCAGTGGCTTCTCCGTTAAATC
>probe:Drosophila_2:1631660_at:422:297; Interrogation_Position=98; Antisense; TCTCCGTTAAATCCGGGTAATGTCA

Paste this into a BLAST search page for me
GTTAAATCCGGGTAATGTCATTATCGTCATTATCAATGGAGATTGCCGTCTGGAGATTGCCGTCATTGTAATGTTATCAGTTTCATTTCAACCGTTGCCAGTCATTGTAATGTTCGCGGAGGCTAGTTCGCGGAGGCTAAATTGGAGTTAAACTTTGATGTTTAGTAACTACAATAACCGTTGCCAACAATATGAAGTGGAAGTGGATGTCCTTGGTCTTTCTATATGTCCTTGGTCTTTCTATGCGGTCTTGGTCTTTCTATGCGGTCTGCTCGTATGCGGTCTGCTCGCCATGGCAGTATGGCAGTGGCTTCTCCGTTAAATCTCTCCGTTAAATCCGGGTAATGTCA

Full Affymetrix probeset data:

Annotations for 1631660_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime