Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631663_at:

>probe:Drosophila_2:1631663_at:510:177; Interrogation_Position=180; Antisense; AAACAGGCCTCTTACCTACGAGATG
>probe:Drosophila_2:1631663_at:555:15; Interrogation_Position=218; Antisense; ATTTTATTGGCCACCGCAAATCGTG
>probe:Drosophila_2:1631663_at:605:555; Interrogation_Position=23; Antisense; GGACGCAAAATTGTTTCTGCCGCAA
>probe:Drosophila_2:1631663_at:375:561; Interrogation_Position=242; Antisense; GGAACTCATGGAACACGTCAACAAT
>probe:Drosophila_2:1631663_at:303:503; Interrogation_Position=285; Antisense; GTCCCAGACCGCCATAGAGGATGTG
>probe:Drosophila_2:1631663_at:515:361; Interrogation_Position=317; Antisense; GCAAGTTTGTCACCGGCACATGGCA
>probe:Drosophila_2:1631663_at:516:499; Interrogation_Position=349; Antisense; GTCTGCTCCGAGGTCATTATCAAGC
>probe:Drosophila_2:1631663_at:330:123; Interrogation_Position=371; Antisense; AGCGACAGCACAACACCATTAGGAT
>probe:Drosophila_2:1631663_at:34:691; Interrogation_Position=405; Antisense; TATTCGGCAGGCGATTACACCGCGA
>probe:Drosophila_2:1631663_at:649:487; Interrogation_Position=435; Antisense; GTACTTCCTTATTGGTTACACGGAG
>probe:Drosophila_2:1631663_at:356:417; Interrogation_Position=460; Antisense; GAGCTGCTCTCCTATTGGATGCAGT
>probe:Drosophila_2:1631663_at:418:445; Interrogation_Position=477; Antisense; GATGCAGTGTCCAGTGACCTTGGAA
>probe:Drosophila_2:1631663_at:25:459; Interrogation_Position=587; Antisense; GATTTACTTAGTGCGTGTACTCGAC
>probe:Drosophila_2:1631663_at:675:615; Interrogation_Position=95; Antisense; TGCAGCAGCTCAGCCGGTCAGGATT

Paste this into a BLAST search page for me
AAACAGGCCTCTTACCTACGAGATGATTTTATTGGCCACCGCAAATCGTGGGACGCAAAATTGTTTCTGCCGCAAGGAACTCATGGAACACGTCAACAATGTCCCAGACCGCCATAGAGGATGTGGCAAGTTTGTCACCGGCACATGGCAGTCTGCTCCGAGGTCATTATCAAGCAGCGACAGCACAACACCATTAGGATTATTCGGCAGGCGATTACACCGCGAGTACTTCCTTATTGGTTACACGGAGGAGCTGCTCTCCTATTGGATGCAGTGATGCAGTGTCCAGTGACCTTGGAAGATTTACTTAGTGCGTGTACTCGACTGCAGCAGCTCAGCCGGTCAGGATT

Full Affymetrix probeset data:

Annotations for 1631663_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime