FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631665_at:

>probe:Drosophila_2:1631665_at:285:215; Interrogation_Position=1049; Antisense; AAGTAAATCGCCCATTCGTCTTTGT
>probe:Drosophila_2:1631665_at:131:363; Interrogation_Position=1143; Antisense; GAATTGCTCCAAGAAATACGCTGAT
>probe:Drosophila_2:1631665_at:294:669; Interrogation_Position=589; Antisense; TACTTTGTCAATAATCCTGGCACTG
>probe:Drosophila_2:1631665_at:444:631; Interrogation_Position=603; Antisense; TCCTGGCACTGGATATGCTTCGAAA
>probe:Drosophila_2:1631665_at:59:105; Interrogation_Position=627; Antisense; AGACCCAACATGTGTGCCCATGATG
>probe:Drosophila_2:1631665_at:383:53; Interrogation_Position=649; Antisense; ATGCACTCATTGTCCTCGTTTGAAA
>probe:Drosophila_2:1631665_at:595:475; Interrogation_Position=666; Antisense; GTTTGAAACCATGTCCACGGACGAG
>probe:Drosophila_2:1631665_at:334:29; Interrogation_Position=702; Antisense; ATACATTCCATTCTCATCGGCAAAC
>probe:Drosophila_2:1631665_at:243:191; Interrogation_Position=724; Antisense; AACTTGGGTATGTTGATCCTCCTGC
>probe:Drosophila_2:1631665_at:573:221; Interrogation_Position=755; Antisense; AAGGTGTCACCTGCAAGGACATTTT
>probe:Drosophila_2:1631665_at:199:225; Interrogation_Position=823; Antisense; AAGGATGTTCACTTGCTACTGCCCA
>probe:Drosophila_2:1631665_at:584:723; Interrogation_Position=835; Antisense; TTGCTACTGCCCATATTCAAGGAGA
>probe:Drosophila_2:1631665_at:666:189; Interrogation_Position=958; Antisense; AACTTCCGAGTCAACCATGGCATAC
>probe:Drosophila_2:1631665_at:640:695; Interrogation_Position=985; Antisense; TTTCAACCCATTCTCCGTTTAGAAG

Paste this into a BLAST search page for me
AAGTAAATCGCCCATTCGTCTTTGTGAATTGCTCCAAGAAATACGCTGATTACTTTGTCAATAATCCTGGCACTGTCCTGGCACTGGATATGCTTCGAAAAGACCCAACATGTGTGCCCATGATGATGCACTCATTGTCCTCGTTTGAAAGTTTGAAACCATGTCCACGGACGAGATACATTCCATTCTCATCGGCAAACAACTTGGGTATGTTGATCCTCCTGCAAGGTGTCACCTGCAAGGACATTTTAAGGATGTTCACTTGCTACTGCCCATTGCTACTGCCCATATTCAAGGAGAAACTTCCGAGTCAACCATGGCATACTTTCAACCCATTCTCCGTTTAGAAG

Full Affymetrix probeset data:

Annotations for 1631665_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720