Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631666_s_at:

>probe:Drosophila_2:1631666_s_at:329:587; Interrogation_Position=527; Antisense; TGGACCCTTCTTATGCGCGCAGTGG
>probe:Drosophila_2:1631666_s_at:31:383; Interrogation_Position=556; Antisense; GAACGCTAGCATGGAGCTCATCAAA
>probe:Drosophila_2:1631666_s_at:454:29; Interrogation_Position=575; Antisense; ATCAAAGTCCTTGTTACGCACGGCG
>probe:Drosophila_2:1631666_s_at:448:565; Interrogation_Position=626; Antisense; GGCAAAACTTGCACTGACTTGGCGA
>probe:Drosophila_2:1631666_s_at:593:401; Interrogation_Position=641; Antisense; GACTTGGCGAAACTTTATCACAGAC
>probe:Drosophila_2:1631666_s_at:324:551; Interrogation_Position=709; Antisense; GGAGAAATCAGTCGCGACCGCAGAC
>probe:Drosophila_2:1631666_s_at:617:295; Interrogation_Position=723; Antisense; CGACCGCAGACGCAGTGACTGCAAT
>probe:Drosophila_2:1631666_s_at:446:405; Interrogation_Position=739; Antisense; GACTGCAATAACGAGGTACACCAAA
>probe:Drosophila_2:1631666_s_at:370:169; Interrogation_Position=799; Antisense; AAAGGACTCTGGCACGGTTCATGAT
>probe:Drosophila_2:1631666_s_at:461:13; Interrogation_Position=822; Antisense; ATTAAAGCCCACGTGACTAAGTCAT
>probe:Drosophila_2:1631666_s_at:57:91; Interrogation_Position=878; Antisense; AGTATTTCGCTTGAAACCCCACAAT
>probe:Drosophila_2:1631666_s_at:356:385; Interrogation_Position=890; Antisense; GAAACCCCACAATGGCCTACAGTTT
>probe:Drosophila_2:1631666_s_at:526:477; Interrogation_Position=911; Antisense; GTTTTACCAACAAAGCCTGCAGATC
>probe:Drosophila_2:1631666_s_at:205:405; Interrogation_Position=970; Antisense; GACTAAGGTCGCTATGAATCGTTGA

Paste this into a BLAST search page for me
TGGACCCTTCTTATGCGCGCAGTGGGAACGCTAGCATGGAGCTCATCAAAATCAAAGTCCTTGTTACGCACGGCGGGCAAAACTTGCACTGACTTGGCGAGACTTGGCGAAACTTTATCACAGACGGAGAAATCAGTCGCGACCGCAGACCGACCGCAGACGCAGTGACTGCAATGACTGCAATAACGAGGTACACCAAAAAAGGACTCTGGCACGGTTCATGATATTAAAGCCCACGTGACTAAGTCATAGTATTTCGCTTGAAACCCCACAATGAAACCCCACAATGGCCTACAGTTTGTTTTACCAACAAAGCCTGCAGATCGACTAAGGTCGCTATGAATCGTTGA

Full Affymetrix probeset data:

Annotations for 1631666_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime