FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631668_at:

>probe:Drosophila_2:1631668_at:375:255; Interrogation_Position=117; Antisense; CAACATTTGCGAGCTGGTGGCGGAA
>probe:Drosophila_2:1631668_at:34:407; Interrogation_Position=166; Antisense; GACTGCGCCTACTACTATGAGTGTG
>probe:Drosophila_2:1631668_at:665:209; Interrogation_Position=193; Antisense; AAGACCGGTAACCATGCGTCCAAGA
>probe:Drosophila_2:1631668_at:231:599; Interrogation_Position=225; Antisense; TGTCACCTCCAAGAAGCGCGAGTAT
>probe:Drosophila_2:1631668_at:313:85; Interrogation_Position=293; Antisense; AGTGCACCGCCCATTCGAAGGAGAA
>probe:Drosophila_2:1631668_at:454:369; Interrogation_Position=309; Antisense; GAAGGAGAACGTCTGCACCAGCAGC
>probe:Drosophila_2:1631668_at:501:53; Interrogation_Position=340; Antisense; ATGACATTCAAATCCGACCAAGCCA
>probe:Drosophila_2:1631668_at:34:457; Interrogation_Position=374; Antisense; GATACTTCGTATGCAAGGCCCTCTA
>probe:Drosophila_2:1631668_at:150:433; Interrogation_Position=439; Antisense; GAGGGCTACTTCTTCGACGAGGATC
>probe:Drosophila_2:1631668_at:519:661; Interrogation_Position=552; Antisense; TAACTGTCACAACTACATCCGGTGT
>probe:Drosophila_2:1631668_at:533:437; Interrogation_Position=598; Antisense; GAGGAAACCTGCCACTGGGATCACT
>probe:Drosophila_2:1631668_at:486:593; Interrogation_Position=613; Antisense; TGGGATCACTTCTTCGACGAGACAG
>probe:Drosophila_2:1631668_at:393:619; Interrogation_Position=646; Antisense; TGCTCCTCCAAGATCATCTACGATA
>probe:Drosophila_2:1631668_at:343:655; Interrogation_Position=669; Antisense; TAAGTGTTGCGATGGCCGGGACTAA

Paste this into a BLAST search page for me
CAACATTTGCGAGCTGGTGGCGGAAGACTGCGCCTACTACTATGAGTGTGAAGACCGGTAACCATGCGTCCAAGATGTCACCTCCAAGAAGCGCGAGTATAGTGCACCGCCCATTCGAAGGAGAAGAAGGAGAACGTCTGCACCAGCAGCATGACATTCAAATCCGACCAAGCCAGATACTTCGTATGCAAGGCCCTCTAGAGGGCTACTTCTTCGACGAGGATCTAACTGTCACAACTACATCCGGTGTGAGGAAACCTGCCACTGGGATCACTTGGGATCACTTCTTCGACGAGACAGTGCTCCTCCAAGATCATCTACGATATAAGTGTTGCGATGGCCGGGACTAA

Full Affymetrix probeset data:

Annotations for 1631668_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720