FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631669_at:

>probe:Drosophila_2:1631669_at:240:449; Interrogation_Position=120; Antisense; GATCCATAGATCTAACCGGCACATC
>probe:Drosophila_2:1631669_at:52:567; Interrogation_Position=137; Antisense; GGCACATCCGACTTTACGAAACCTT
>probe:Drosophila_2:1631669_at:512:135; Interrogation_Position=152; Antisense; ACGAAACCTTTGTTCCAGTGAGCCA
>probe:Drosophila_2:1631669_at:413:85; Interrogation_Position=168; Antisense; AGTGAGCCAAGTTCATCCGCTAACA
>probe:Drosophila_2:1631669_at:527:661; Interrogation_Position=188; Antisense; TAACACGGAAGTTCTACGCCCAGTA
>probe:Drosophila_2:1631669_at:184:683; Interrogation_Position=211; Antisense; TATGAGCAACGCCAGCCGACGGATA
>probe:Drosophila_2:1631669_at:299:457; Interrogation_Position=232; Antisense; GATACCTTGAGGTACCTACGGCACA
>probe:Drosophila_2:1631669_at:48:567; Interrogation_Position=251; Antisense; GGCACACTTGGCCTGAGAAGCATGT
>probe:Drosophila_2:1631669_at:11:559; Interrogation_Position=295; Antisense; GGAAAAGCTGTTCCGCTCCTGGAGT
>probe:Drosophila_2:1631669_at:115:515; Interrogation_Position=325; Antisense; GTGTACGGCTGGTTGCCGCTCAAAA
>probe:Drosophila_2:1631669_at:309:293; Interrogation_Position=366; Antisense; CGATCTGAACTTTCTGCATGCCAAG
>probe:Drosophila_2:1631669_at:291:625; Interrogation_Position=395; Antisense; TGCGCTGCGGCATGACTGTTCACGG
>probe:Drosophila_2:1631669_at:237:709; Interrogation_Position=461; Antisense; TTAACGGACTCAGATTCCTGCTTCA
>probe:Drosophila_2:1631669_at:542:227; Interrogation_Position=52; Antisense; AATGGCGACGCACTGGATCATCGCG

Paste this into a BLAST search page for me
GATCCATAGATCTAACCGGCACATCGGCACATCCGACTTTACGAAACCTTACGAAACCTTTGTTCCAGTGAGCCAAGTGAGCCAAGTTCATCCGCTAACATAACACGGAAGTTCTACGCCCAGTATATGAGCAACGCCAGCCGACGGATAGATACCTTGAGGTACCTACGGCACAGGCACACTTGGCCTGAGAAGCATGTGGAAAAGCTGTTCCGCTCCTGGAGTGTGTACGGCTGGTTGCCGCTCAAAACGATCTGAACTTTCTGCATGCCAAGTGCGCTGCGGCATGACTGTTCACGGTTAACGGACTCAGATTCCTGCTTCAAATGGCGACGCACTGGATCATCGCG

Full Affymetrix probeset data:

Annotations for 1631669_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720