FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631670_at:

>probe:Drosophila_2:1631670_at:36:245; Interrogation_Position=1063; Antisense; AATTCAAGCCTGTCCATGCTAATTT
>probe:Drosophila_2:1631670_at:274:1; Interrogation_Position=1078; Antisense; ATGCTAATTTTTCTACCGGACCAGG
>probe:Drosophila_2:1631670_at:498:131; Interrogation_Position=1092; Antisense; ACCGGACCAGGTCGATGGACTATCA
>probe:Drosophila_2:1631670_at:351:443; Interrogation_Position=1165; Antisense; GATGTAACTTTAAGGCTTCCCAAGT
>probe:Drosophila_2:1631670_at:526:635; Interrogation_Position=1196; Antisense; TCGAATTCTTCGCTCAACTAAACAA
>probe:Drosophila_2:1631670_at:450:159; Interrogation_Position=1217; Antisense; ACAAAGTTCTTGTGGCGATGGGCAT
>probe:Drosophila_2:1631670_at:173:171; Interrogation_Position=1309; Antisense; AAAGTCATTCATAAGGCGTTCATCG
>probe:Drosophila_2:1631670_at:498:573; Interrogation_Position=1362; Antisense; GGCTGCAACAGCTTTACTTTTCGTG
>probe:Drosophila_2:1631670_at:56:701; Interrogation_Position=1379; Antisense; TTTTCGTGCGCTATAGTATGCCTAT
>probe:Drosophila_2:1631670_at:644:49; Interrogation_Position=1396; Antisense; ATGCCTATGCCGTCATCTCAAATGG
>probe:Drosophila_2:1631670_at:390:709; Interrogation_Position=1424; Antisense; TTAATGCCGATCATCCTTTTGCCTA
>probe:Drosophila_2:1631670_at:670:389; Interrogation_Position=1465; Antisense; GAAACCATTTATTTCCAGGGCCACT
>probe:Drosophila_2:1631670_at:372:307; Interrogation_Position=1479; Antisense; CCAGGGCCACTTTGTGAAACCGAAT
>probe:Drosophila_2:1631670_at:717:17; Interrogation_Position=996; Antisense; ATTTCAATCATTTAGGGCCGCACAT

Paste this into a BLAST search page for me
AATTCAAGCCTGTCCATGCTAATTTATGCTAATTTTTCTACCGGACCAGGACCGGACCAGGTCGATGGACTATCAGATGTAACTTTAAGGCTTCCCAAGTTCGAATTCTTCGCTCAACTAAACAAACAAAGTTCTTGTGGCGATGGGCATAAAGTCATTCATAAGGCGTTCATCGGGCTGCAACAGCTTTACTTTTCGTGTTTTCGTGCGCTATAGTATGCCTATATGCCTATGCCGTCATCTCAAATGGTTAATGCCGATCATCCTTTTGCCTAGAAACCATTTATTTCCAGGGCCACTCCAGGGCCACTTTGTGAAACCGAATATTTCAATCATTTAGGGCCGCACAT

Full Affymetrix probeset data:

Annotations for 1631670_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720