FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631671_at:

>probe:Drosophila_2:1631671_at:12:407; Interrogation_Position=406; Antisense; GACGGCCAACATTGTGGATTTGCTC
>probe:Drosophila_2:1631671_at:649:19; Interrogation_Position=423; Antisense; ATTTGCTCTACTATCCCATCGAGAA
>probe:Drosophila_2:1631671_at:558:527; Interrogation_Position=501; Antisense; GGGACAATGTCAACTCCATATTCTG
>probe:Drosophila_2:1631671_at:414:307; Interrogation_Position=516; Antisense; CCATATTCTGGGTGCTTTCGGTGTA
>probe:Drosophila_2:1631671_at:553:693; Interrogation_Position=531; Antisense; TTTCGGTGTACCTGAACCTCATGAG
>probe:Drosophila_2:1631671_at:85:613; Interrogation_Position=624; Antisense; TGAAAACGTTGACCAAGCACCGCCT
>probe:Drosophila_2:1631671_at:539:441; Interrogation_Position=652; Antisense; GATGGTGTCCATCGTTCGGATCTCA
>probe:Drosophila_2:1631671_at:294:717; Interrogation_Position=666; Antisense; TTCGGATCTCACTCGACTTTGTGCA
>probe:Drosophila_2:1631671_at:162:293; Interrogation_Position=694; Antisense; CGTCAGCACGCTGCCGAAAGGATAT
>probe:Drosophila_2:1631671_at:84:347; Interrogation_Position=783; Antisense; GCATCTACCAGATCTTTGCCAAGAG
>probe:Drosophila_2:1631671_at:649:141; Interrogation_Position=811; Antisense; ACTGAACAAGTAGTCGGTCCGCCGT
>probe:Drosophila_2:1631671_at:351:535; Interrogation_Position=826; Antisense; GGTCCGCCGTTGTATTTGCAATCCG
>probe:Drosophila_2:1631671_at:14:361; Interrogation_Position=843; Antisense; GCAATCCGTGTACTCGTATTTGTTG
>probe:Drosophila_2:1631671_at:347:515; Interrogation_Position=932; Antisense; GTGTGTTTAGCCAGTATGTCCTTTA

Paste this into a BLAST search page for me
GACGGCCAACATTGTGGATTTGCTCATTTGCTCTACTATCCCATCGAGAAGGGACAATGTCAACTCCATATTCTGCCATATTCTGGGTGCTTTCGGTGTATTTCGGTGTACCTGAACCTCATGAGTGAAAACGTTGACCAAGCACCGCCTGATGGTGTCCATCGTTCGGATCTCATTCGGATCTCACTCGACTTTGTGCACGTCAGCACGCTGCCGAAAGGATATGCATCTACCAGATCTTTGCCAAGAGACTGAACAAGTAGTCGGTCCGCCGTGGTCCGCCGTTGTATTTGCAATCCGGCAATCCGTGTACTCGTATTTGTTGGTGTGTTTAGCCAGTATGTCCTTTA

Full Affymetrix probeset data:

Annotations for 1631671_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720