Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631673_s_at:

>probe:Drosophila_2:1631673_s_at:415:185; Interrogation_Position=15; Antisense; AACAAAATGCGCTTCCTATTCGCTC
>probe:Drosophila_2:1631673_s_at:386:185; Interrogation_Position=18; Antisense; AAAATGCGCTTCCTATTCGCTCTAC
>probe:Drosophila_2:1631673_s_at:18:235; Interrogation_Position=20; Antisense; AATGCGCTTCCTATTCGCTCTACTT
>probe:Drosophila_2:1631673_s_at:507:77; Interrogation_Position=237; Antisense; AGGAGGCGCAGACGTGCTCGCCGTC
>probe:Drosophila_2:1631673_s_at:349:637; Interrogation_Position=260; Antisense; TCGTCGCCTGGCTCGTGAGCGCCGT
>probe:Drosophila_2:1631673_s_at:650:633; Interrogation_Position=287; Antisense; TCGCCAGGAGCGGAGACAGCGCCAG
>probe:Drosophila_2:1631673_s_at:107:691; Interrogation_Position=31; Antisense; TATTCGCTCTACTTCTCAGCGTGCT
>probe:Drosophila_2:1631673_s_at:109:549; Interrogation_Position=319; Antisense; GGAGGCGCAGGATGGAGCAGCTGCT
>probe:Drosophila_2:1631673_s_at:80:623; Interrogation_Position=340; Antisense; TGCTGGTGAGGCAGCGTCGCCTGAT
>probe:Drosophila_2:1631673_s_at:608:667; Interrogation_Position=40; Antisense; TACTTCTCAGCGTGCTCCTGTGTCT
>probe:Drosophila_2:1631673_s_at:279:715; Interrogation_Position=43; Antisense; TTCTCAGCGTGCTCCTGTGTCTGCT
>probe:Drosophila_2:1631673_s_at:569:121; Interrogation_Position=48; Antisense; AGCGTGCTCCTGTGTCTGCTCCTGG
>probe:Drosophila_2:1631673_s_at:357:631; Interrogation_Position=55; Antisense; TCCTGTGTCTGCTCCTGGCTCAGGA
>probe:Drosophila_2:1631673_s_at:207:643; Interrogation_Position=62; Antisense; TCTGCTCCTGGCTCAGGAGGGCAGT

Paste this into a BLAST search page for me
AACAAAATGCGCTTCCTATTCGCTCAAAATGCGCTTCCTATTCGCTCTACAATGCGCTTCCTATTCGCTCTACTTAGGAGGCGCAGACGTGCTCGCCGTCTCGTCGCCTGGCTCGTGAGCGCCGTTCGCCAGGAGCGGAGACAGCGCCAGTATTCGCTCTACTTCTCAGCGTGCTGGAGGCGCAGGATGGAGCAGCTGCTTGCTGGTGAGGCAGCGTCGCCTGATTACTTCTCAGCGTGCTCCTGTGTCTTTCTCAGCGTGCTCCTGTGTCTGCTAGCGTGCTCCTGTGTCTGCTCCTGGTCCTGTGTCTGCTCCTGGCTCAGGATCTGCTCCTGGCTCAGGAGGGCAGT

Full Affymetrix probeset data:

Annotations for 1631673_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime