Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631674_at:

>probe:Drosophila_2:1631674_at:116:661; Interrogation_Position=1020; Antisense; TAAACACGGCCCTTAGTCGCATGGG
>probe:Drosophila_2:1631674_at:280:347; Interrogation_Position=1044; Antisense; GCATCAGTGTGCACAAGCTGCCGGA
>probe:Drosophila_2:1631674_at:333:77; Interrogation_Position=1068; Antisense; AGGATGATCCTTACCTGGACTTGGC
>probe:Drosophila_2:1631674_at:580:147; Interrogation_Position=1086; Antisense; ACTTGGCCATTCTCGGACAGTCGAA
>probe:Drosophila_2:1631674_at:104:501; Interrogation_Position=1105; Antisense; GTCGAACCACTTTATCGGCAACTGT
>probe:Drosophila_2:1631674_at:179:687; Interrogation_Position=1129; Antisense; TATATCCTCTTACTCGGCATTCGAA
>probe:Drosophila_2:1631674_at:720:379; Interrogation_Position=1160; Antisense; GAACGAGATGTGCACGGTTTTCCAT
>probe:Drosophila_2:1631674_at:254:595; Interrogation_Position=759; Antisense; TGGGCATTCATCTGCGCAACGGTAT
>probe:Drosophila_2:1631674_at:227:79; Interrogation_Position=813; Antisense; AGGATAGCCAGCATCTGTTTGCCTC
>probe:Drosophila_2:1631674_at:617:167; Interrogation_Position=859; Antisense; AAATGAACGTGGTGCACTCTACCCG
>probe:Drosophila_2:1631674_at:445:327; Interrogation_Position=908; Antisense; GCGATCATCCGCCAGCTAAAGAGAA
>probe:Drosophila_2:1631674_at:41:109; Interrogation_Position=929; Antisense; AGAACCATTAAGAACGTGCGCCAAA
>probe:Drosophila_2:1631674_at:730:33; Interrogation_Position=971; Antisense; ATCAAATCAGTTTTCGTGGCGTCAG
>probe:Drosophila_2:1631674_at:12:583; Interrogation_Position=987; Antisense; TGGCGTCAGACTCCAATCACATGAT

Paste this into a BLAST search page for me
TAAACACGGCCCTTAGTCGCATGGGGCATCAGTGTGCACAAGCTGCCGGAAGGATGATCCTTACCTGGACTTGGCACTTGGCCATTCTCGGACAGTCGAAGTCGAACCACTTTATCGGCAACTGTTATATCCTCTTACTCGGCATTCGAAGAACGAGATGTGCACGGTTTTCCATTGGGCATTCATCTGCGCAACGGTATAGGATAGCCAGCATCTGTTTGCCTCAAATGAACGTGGTGCACTCTACCCGGCGATCATCCGCCAGCTAAAGAGAAAGAACCATTAAGAACGTGCGCCAAAATCAAATCAGTTTTCGTGGCGTCAGTGGCGTCAGACTCCAATCACATGAT

Full Affymetrix probeset data:

Annotations for 1631674_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime