Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631676_at:

>probe:Drosophila_2:1631676_at:437:537; Interrogation_Position=3733; Antisense; GGTCATATCGGCCATCACGCAGTAC
>probe:Drosophila_2:1631676_at:154:237; Interrogation_Position=3789; Antisense; AATCGCTGGTCCATCGATTTGGCCG
>probe:Drosophila_2:1631676_at:221:529; Interrogation_Position=3814; Antisense; GGGTCATGGTATGTCTGTGCTGAAT
>probe:Drosophila_2:1631676_at:206:243; Interrogation_Position=3836; Antisense; AATATGACCTTGAGCAGCGTGGCCT
>probe:Drosophila_2:1631676_at:579:113; Interrogation_Position=3848; Antisense; AGCAGCGTGGCCTCTAACGTGGAGT
>probe:Drosophila_2:1631676_at:286:105; Interrogation_Position=3888; Antisense; AGACGTCGCTCTACAAGTGGGTGGA
>probe:Drosophila_2:1631676_at:233:399; Interrogation_Position=3948; Antisense; GACACGAAGGTCCTGTCACAGTTCT
>probe:Drosophila_2:1631676_at:517:715; Interrogation_Position=3969; Antisense; TTCTCTCTTCACACACTCATTTGTA
>probe:Drosophila_2:1631676_at:668:493; Interrogation_Position=3991; Antisense; GTAATTATGTTCCTCTCTCAGACAC
>probe:Drosophila_2:1631676_at:110:513; Interrogation_Position=4027; Antisense; GTGAGCTTTGATTTCGCCAAGTTAA
>probe:Drosophila_2:1631676_at:456:489; Interrogation_Position=4070; Antisense; GTACTCTTTACCATATCATTGCCAA
>probe:Drosophila_2:1631676_at:727:7; Interrogation_Position=4087; Antisense; ATTGCCAATTCGATCGATCTCCTTG
>probe:Drosophila_2:1631676_at:401:39; Interrogation_Position=4103; Antisense; ATCTCCTTGGTTTTCTCTGTAGCTA
>probe:Drosophila_2:1631676_at:327:389; Interrogation_Position=4230; Antisense; GAAAACCTTTTCTAGCACATACGAA

Paste this into a BLAST search page for me
GGTCATATCGGCCATCACGCAGTACAATCGCTGGTCCATCGATTTGGCCGGGGTCATGGTATGTCTGTGCTGAATAATATGACCTTGAGCAGCGTGGCCTAGCAGCGTGGCCTCTAACGTGGAGTAGACGTCGCTCTACAAGTGGGTGGAGACACGAAGGTCCTGTCACAGTTCTTTCTCTCTTCACACACTCATTTGTAGTAATTATGTTCCTCTCTCAGACACGTGAGCTTTGATTTCGCCAAGTTAAGTACTCTTTACCATATCATTGCCAAATTGCCAATTCGATCGATCTCCTTGATCTCCTTGGTTTTCTCTGTAGCTAGAAAACCTTTTCTAGCACATACGAA

Full Affymetrix probeset data:

Annotations for 1631676_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime