FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631677_at:

>probe:Drosophila_2:1631677_at:725:267; Interrogation_Position=2113; Antisense; CAGGACACCTGCACGAGCCGAGCGG
>probe:Drosophila_2:1631677_at:416:311; Interrogation_Position=2189; Antisense; GCCCGGAGCCGGAGTGTATCCCACG
>probe:Drosophila_2:1631677_at:140:189; Interrogation_Position=2312; Antisense; AACAGCACCTGGCAAGCATCCAGAG
>probe:Drosophila_2:1631677_at:309:209; Interrogation_Position=2343; Antisense; AAGCACGAGGCGGACTAAGACAAGG
>probe:Drosophila_2:1631677_at:184:657; Interrogation_Position=2358; Antisense; TAAGACAAGGAATCCCACCACCCAG
>probe:Drosophila_2:1631677_at:3:95; Interrogation_Position=2381; Antisense; AGATCCTAGTTGTGGTCCCTAACTT
>probe:Drosophila_2:1631677_at:174:23; Interrogation_Position=2406; Antisense; ATATATGAATCGATCCCTGGTGTTG
>probe:Drosophila_2:1631677_at:75:593; Interrogation_Position=2423; Antisense; TGGTGTTGTAACATAGCTGTCCCCT
>probe:Drosophila_2:1631677_at:525:371; Interrogation_Position=2461; Antisense; GAAGGCAAACAACCGGAATGCTCTT
>probe:Drosophila_2:1631677_at:62:369; Interrogation_Position=2476; Antisense; GAATGCTCTTAACTTGAAATCCCTA
>probe:Drosophila_2:1631677_at:591:611; Interrogation_Position=2490; Antisense; TGAAATCCCTATTTAGGCGCCACAC
>probe:Drosophila_2:1631677_at:318:657; Interrogation_Position=2516; Antisense; TAAGAACTCCACATCAATCCCATTC
>probe:Drosophila_2:1631677_at:266:653; Interrogation_Position=2592; Antisense; TAATAACTGAGTGTGCGTCGCATTC
>probe:Drosophila_2:1631677_at:491:329; Interrogation_Position=2606; Antisense; GCGTCGCATTCTGGACTGTATGCTA

Paste this into a BLAST search page for me
CAGGACACCTGCACGAGCCGAGCGGGCCCGGAGCCGGAGTGTATCCCACGAACAGCACCTGGCAAGCATCCAGAGAAGCACGAGGCGGACTAAGACAAGGTAAGACAAGGAATCCCACCACCCAGAGATCCTAGTTGTGGTCCCTAACTTATATATGAATCGATCCCTGGTGTTGTGGTGTTGTAACATAGCTGTCCCCTGAAGGCAAACAACCGGAATGCTCTTGAATGCTCTTAACTTGAAATCCCTATGAAATCCCTATTTAGGCGCCACACTAAGAACTCCACATCAATCCCATTCTAATAACTGAGTGTGCGTCGCATTCGCGTCGCATTCTGGACTGTATGCTA

Full Affymetrix probeset data:

Annotations for 1631677_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720