Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631680_a_at:

>probe:Drosophila_2:1631680_a_at:28:195; Interrogation_Position=149; Antisense; AACTCCAACTTGTTCGCCATGAATG
>probe:Drosophila_2:1631680_a_at:286:307; Interrogation_Position=165; Antisense; CCATGAATGTCCTGGCTGGAATCAT
>probe:Drosophila_2:1631680_a_at:199:585; Interrogation_Position=181; Antisense; TGGAATCATTGCCAGCCATCCGGAT
>probe:Drosophila_2:1631680_a_at:287:127; Interrogation_Position=194; Antisense; AGCCATCCGGATGAGCTGATCGCTA
>probe:Drosophila_2:1631680_a_at:113:45; Interrogation_Position=212; Antisense; ATCGCTAGTCCTGCCCAATATGAGT
>probe:Drosophila_2:1631680_a_at:361:243; Interrogation_Position=228; Antisense; AATATGAGTTCCACTACTCCGTTCA
>probe:Drosophila_2:1631680_a_at:688:711; Interrogation_Position=249; Antisense; TTCACGACAGTCACAGCGGCGATGT
>probe:Drosophila_2:1631680_a_at:46:473; Interrogation_Position=272; Antisense; GTTAAGGATCAGTTCGAGCATCGAC
>probe:Drosophila_2:1631680_a_at:487:471; Interrogation_Position=283; Antisense; GTTCGAGCATCGACGTGGCGAGTAC
>probe:Drosophila_2:1631680_a_at:322:575; Interrogation_Position=299; Antisense; GGCGAGTACGTAACTGGTCGCTACT
>probe:Drosophila_2:1631680_a_at:634:519; Interrogation_Position=329; Antisense; GTGGATCCCGATGGTCACCGTCGCA
>probe:Drosophila_2:1631680_a_at:43:145; Interrogation_Position=376; Antisense; ACTGCTGGGCTTCAATGCTCAGGTT
>probe:Drosophila_2:1631680_a_at:528:711; Interrogation_Position=386; Antisense; TTCAATGCTCAGGTTCGTCGGGAAC
>probe:Drosophila_2:1631680_a_at:533:637; Interrogation_Position=403; Antisense; TCGGGAACCGATTTCTCGCTACTGA

Paste this into a BLAST search page for me
AACTCCAACTTGTTCGCCATGAATGCCATGAATGTCCTGGCTGGAATCATTGGAATCATTGCCAGCCATCCGGATAGCCATCCGGATGAGCTGATCGCTAATCGCTAGTCCTGCCCAATATGAGTAATATGAGTTCCACTACTCCGTTCATTCACGACAGTCACAGCGGCGATGTGTTAAGGATCAGTTCGAGCATCGACGTTCGAGCATCGACGTGGCGAGTACGGCGAGTACGTAACTGGTCGCTACTGTGGATCCCGATGGTCACCGTCGCAACTGCTGGGCTTCAATGCTCAGGTTTTCAATGCTCAGGTTCGTCGGGAACTCGGGAACCGATTTCTCGCTACTGA

Full Affymetrix probeset data:

Annotations for 1631680_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime