Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631681_s_at:

>probe:Drosophila_2:1631681_s_at:710:331; Interrogation_Position=100; Antisense; GCTGTCGTCGTTCTCGCTCTCGTTG
>probe:Drosophila_2:1631681_s_at:607:501; Interrogation_Position=106; Antisense; GTCGTTCTCGCTCTCGTTGCCTGCG
>probe:Drosophila_2:1631681_s_at:129:53; Interrogation_Position=13; Antisense; ATGCTCCACGAAGAGCAGTGGGATA
>probe:Drosophila_2:1631681_s_at:302:415; Interrogation_Position=25; Antisense; GAGCAGTGGGATATCAAAGAGTTTC
>probe:Drosophila_2:1631681_s_at:17:685; Interrogation_Position=36; Antisense; TATCAAAGAGTTTCTAGCCTTCCGA
>probe:Drosophila_2:1631681_s_at:689:255; Interrogation_Position=39; Antisense; CAAAGAGTTTCTAGCCTTCCGAAGA
>probe:Drosophila_2:1631681_s_at:685:99; Interrogation_Position=42; Antisense; AGAGTTTCTAGCCTTCCGAAGAAGC
>probe:Drosophila_2:1631681_s_at:513:475; Interrogation_Position=45; Antisense; GTTTCTAGCCTTCCGAAGAAGCAAA
>probe:Drosophila_2:1631681_s_at:139:277; Interrogation_Position=49; Antisense; CTAGCCTTCCGAAGAAGCAAACCAA
>probe:Drosophila_2:1631681_s_at:8:357; Interrogation_Position=65; Antisense; GCAAACCAAACAAATATTTCACCAT
>probe:Drosophila_2:1631681_s_at:675:695; Interrogation_Position=81; Antisense; TTTCACCATGTTCAAATACGCTGTC
>probe:Drosophila_2:1631681_s_at:269:129; Interrogation_Position=85; Antisense; ACCATGTTCAAATACGCTGTCGTCG
>probe:Drosophila_2:1631681_s_at:112:473; Interrogation_Position=90; Antisense; GTTCAAATACGCTGTCGTCGTTCTC
>probe:Drosophila_2:1631681_s_at:637:163; Interrogation_Position=94; Antisense; AAATACGCTGTCGTCGTTCTCGCTC

Paste this into a BLAST search page for me
GCTGTCGTCGTTCTCGCTCTCGTTGGTCGTTCTCGCTCTCGTTGCCTGCGATGCTCCACGAAGAGCAGTGGGATAGAGCAGTGGGATATCAAAGAGTTTCTATCAAAGAGTTTCTAGCCTTCCGACAAAGAGTTTCTAGCCTTCCGAAGAAGAGTTTCTAGCCTTCCGAAGAAGCGTTTCTAGCCTTCCGAAGAAGCAAACTAGCCTTCCGAAGAAGCAAACCAAGCAAACCAAACAAATATTTCACCATTTTCACCATGTTCAAATACGCTGTCACCATGTTCAAATACGCTGTCGTCGGTTCAAATACGCTGTCGTCGTTCTCAAATACGCTGTCGTCGTTCTCGCTC

Full Affymetrix probeset data:

Annotations for 1631681_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime