Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631682_at:

>probe:Drosophila_2:1631682_at:706:395; Interrogation_Position=1570; Antisense; GACAAGCTCAGCAAGATCCAGACCC
>probe:Drosophila_2:1631682_at:462:103; Interrogation_Position=1589; Antisense; AGACCCTCAAACTGGCCACAAGATA
>probe:Drosophila_2:1631682_at:676:215; Interrogation_Position=1608; Antisense; AAGATACATTGACTTCCTGTGCCGC
>probe:Drosophila_2:1631682_at:144:627; Interrogation_Position=1627; Antisense; TGCCGCATGCTCAGCTCGAGTGATA
>probe:Drosophila_2:1631682_at:80:685; Interrogation_Position=1652; Antisense; TATCTTTGCTGAAGGCCTTGGAGGC
>probe:Drosophila_2:1631682_at:495:451; Interrogation_Position=1747; Antisense; GATCTGAAGTGCCTGCGCAAGGCCA
>probe:Drosophila_2:1631682_at:512:361; Interrogation_Position=1763; Antisense; GCAAGGCCAACGGAGCACCCATTAT
>probe:Drosophila_2:1631682_at:705:703; Interrogation_Position=1784; Antisense; TTATCCCGCCCGAGAAGCTGAGTTA
>probe:Drosophila_2:1631682_at:327:411; Interrogation_Position=1837; Antisense; GACGCGCAGCACCAGAAGGCATAGC
>probe:Drosophila_2:1631682_at:59:571; Interrogation_Position=1854; Antisense; GGCATAGCGGCGGATCAGGACACTA
>probe:Drosophila_2:1631682_at:46:353; Interrogation_Position=1899; Antisense; GCAGCAACTATCGTGTGAATTCCAG
>probe:Drosophila_2:1631682_at:101:247; Interrogation_Position=1946; Antisense; AATTCTCTGTCACGCTTTCCATATA
>probe:Drosophila_2:1631682_at:1:343; Interrogation_Position=1959; Antisense; GCTTTCCATATATACGTGTCGACTA
>probe:Drosophila_2:1631682_at:600:439; Interrogation_Position=1995; Antisense; GATGTCTAAGCCTAAAAACCTACTG

Paste this into a BLAST search page for me
GACAAGCTCAGCAAGATCCAGACCCAGACCCTCAAACTGGCCACAAGATAAAGATACATTGACTTCCTGTGCCGCTGCCGCATGCTCAGCTCGAGTGATATATCTTTGCTGAAGGCCTTGGAGGCGATCTGAAGTGCCTGCGCAAGGCCAGCAAGGCCAACGGAGCACCCATTATTTATCCCGCCCGAGAAGCTGAGTTAGACGCGCAGCACCAGAAGGCATAGCGGCATAGCGGCGGATCAGGACACTAGCAGCAACTATCGTGTGAATTCCAGAATTCTCTGTCACGCTTTCCATATAGCTTTCCATATATACGTGTCGACTAGATGTCTAAGCCTAAAAACCTACTG

Full Affymetrix probeset data:

Annotations for 1631682_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime