Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631684_at:

>probe:Drosophila_2:1631684_at:288:161; Interrogation_Position=451; Antisense; ACAAGTCGAGACGTTACTCCTGCGT
>probe:Drosophila_2:1631684_at:7:525; Interrogation_Position=497; Antisense; GGGCGAGCTGCAGACCGTAAATCCG
>probe:Drosophila_2:1631684_at:61:371; Interrogation_Position=529; Antisense; GAATGGGTGACTTCTTCGGCGCCGA
>probe:Drosophila_2:1631684_at:272:315; Interrogation_Position=567; Antisense; GCCTTTGGACTGTGGAGCGCTGTAC
>probe:Drosophila_2:1631684_at:301:725; Interrogation_Position=612; Antisense; TTGTGGTTCGGCAACAGTCGCAGTC
>probe:Drosophila_2:1631684_at:496:87; Interrogation_Position=633; Antisense; AGTCCACTGGGTGCCACATTCATAA
>probe:Drosophila_2:1631684_at:294:247; Interrogation_Position=673; Antisense; AATTGGGCCTCTGTGTTCTGTGGAA
>probe:Drosophila_2:1631684_at:594:563; Interrogation_Position=694; Antisense; GGAATGTCCACTGTCTTTGGCGCAT
>probe:Drosophila_2:1631684_at:99:43; Interrogation_Position=723; Antisense; ATCGTCGACGAGCACTGGTGGTCAC
>probe:Drosophila_2:1631684_at:568:283; Interrogation_Position=759; Antisense; CTGCTTGTTCTGCTGAATCACTTTG
>probe:Drosophila_2:1631684_at:67:367; Interrogation_Position=773; Antisense; GAATCACTTTGTCCTGTGGCGACTG
>probe:Drosophila_2:1631684_at:215:313; Interrogation_Position=831; Antisense; GCCACCGTGGGCATGTGCTTTAGCA
>probe:Drosophila_2:1631684_at:511:705; Interrogation_Position=850; Antisense; TTAGCACCATCTTTGCGCTGAATGC
>probe:Drosophila_2:1631684_at:261:129; Interrogation_Position=926; Antisense; ACCAGGGACTGGAGCCTTGATTGCC

Paste this into a BLAST search page for me
ACAAGTCGAGACGTTACTCCTGCGTGGGCGAGCTGCAGACCGTAAATCCGGAATGGGTGACTTCTTCGGCGCCGAGCCTTTGGACTGTGGAGCGCTGTACTTGTGGTTCGGCAACAGTCGCAGTCAGTCCACTGGGTGCCACATTCATAAAATTGGGCCTCTGTGTTCTGTGGAAGGAATGTCCACTGTCTTTGGCGCATATCGTCGACGAGCACTGGTGGTCACCTGCTTGTTCTGCTGAATCACTTTGGAATCACTTTGTCCTGTGGCGACTGGCCACCGTGGGCATGTGCTTTAGCATTAGCACCATCTTTGCGCTGAATGCACCAGGGACTGGAGCCTTGATTGCC

Full Affymetrix probeset data:

Annotations for 1631684_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime