Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631687_at:

>probe:Drosophila_2:1631687_at:104:159; Interrogation_Position=2110; Antisense; ACACACTTTGTACATACACCGCGGG
>probe:Drosophila_2:1631687_at:442:617; Interrogation_Position=2116; Antisense; TTTGTACATACACCGCGGGAAGCTT
>probe:Drosophila_2:1631687_at:565:523; Interrogation_Position=2142; Antisense; GGGCACGACTTGGTAGTGACTTAGA
>probe:Drosophila_2:1631687_at:190:539; Interrogation_Position=2153; Antisense; GGTAGTGACTTAGATGCGCCAAATT
>probe:Drosophila_2:1631687_at:288:145; Interrogation_Position=2293; Antisense; ACTACAAAGCGGTTAGAAGTCTATT
>probe:Drosophila_2:1631687_at:265:489; Interrogation_Position=2373; Antisense; GTACTTGTATATACGTACCAAACAA
>probe:Drosophila_2:1631687_at:56:181; Interrogation_Position=2414; Antisense; AAAAAGTTACGTCCATGAAATGCAA
>probe:Drosophila_2:1631687_at:699:289; Interrogation_Position=2496; Antisense; CGTACGATTACGCTAGATTTATGTA
>probe:Drosophila_2:1631687_at:599:601; Interrogation_Position=2517; Antisense; TGTATAGTTATACCCTCATAGCAGT
>probe:Drosophila_2:1631687_at:500:27; Interrogation_Position=2526; Antisense; ATACCCTCATAGCAGTACACGAACC
>probe:Drosophila_2:1631687_at:705:663; Interrogation_Position=2541; Antisense; TACACGAACCGAGCAAACTGACAAA
>probe:Drosophila_2:1631687_at:529:363; Interrogation_Position=2615; Antisense; GAATCACTAGTTTAAGTTTCTCAGC
>probe:Drosophila_2:1631687_at:195:15; Interrogation_Position=2668; Antisense; ATTATGTTCAACAACGTCTCCAAAT
>probe:Drosophila_2:1631687_at:361:499; Interrogation_Position=2683; Antisense; GTCTCCAAATAAAACTGTCAACTGA

Paste this into a BLAST search page for me
ACACACTTTGTACATACACCGCGGGTTTGTACATACACCGCGGGAAGCTTGGGCACGACTTGGTAGTGACTTAGAGGTAGTGACTTAGATGCGCCAAATTACTACAAAGCGGTTAGAAGTCTATTGTACTTGTATATACGTACCAAACAAAAAAAGTTACGTCCATGAAATGCAACGTACGATTACGCTAGATTTATGTATGTATAGTTATACCCTCATAGCAGTATACCCTCATAGCAGTACACGAACCTACACGAACCGAGCAAACTGACAAAGAATCACTAGTTTAAGTTTCTCAGCATTATGTTCAACAACGTCTCCAAATGTCTCCAAATAAAACTGTCAACTGA

Full Affymetrix probeset data:

Annotations for 1631687_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime