FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631688_at:

>probe:Drosophila_2:1631688_at:54:407; Interrogation_Position=2625; Antisense; GACTGTGGATCGTTTTCGGGCAAAT
>probe:Drosophila_2:1631688_at:402:567; Interrogation_Position=2643; Antisense; GGCAAATATCATCATCGACACGGGC
>probe:Drosophila_2:1631688_at:147:607; Interrogation_Position=2676; Antisense; TGAGGAGCTTACCTACAAGGCCCTG
>probe:Drosophila_2:1631688_at:238:243; Interrogation_Position=2717; Antisense; AATTTCAGGTGGAGGGTCCCTGCCA
>probe:Drosophila_2:1631688_at:425:123; Interrogation_Position=2741; Antisense; AGCGCTGCGACATGATCTGCATTAA
>probe:Drosophila_2:1631688_at:390:293; Interrogation_Position=2833; Antisense; CGATTCGGCATCTACATCACTAGGA
>probe:Drosophila_2:1631688_at:719:551; Interrogation_Position=2889; Antisense; GGAGCAACACATGACCTGCGGCGAT
>probe:Drosophila_2:1631688_at:33:285; Interrogation_Position=2904; Antisense; CTGCGGCGATGTTGTCCTTGTGGAA
>probe:Drosophila_2:1631688_at:82:209; Interrogation_Position=2930; Antisense; AAGCTCACTTTACATCACTTCAGCG
>probe:Drosophila_2:1631688_at:67:149; Interrogation_Position=2946; Antisense; ACTTCAGCGTGGTTTTCTTCGTTCT
>probe:Drosophila_2:1631688_at:281:655; Interrogation_Position=3030; Antisense; TAATTCTCTATTACGTTGCATCACG
>probe:Drosophila_2:1631688_at:123:271; Interrogation_Position=3048; Antisense; CATCACGTTTCGCACTTAGTTTGTT
>probe:Drosophila_2:1631688_at:686:165; Interrogation_Position=3140; Antisense; AAAGTAACCGGATACCTCTTGCCAG
>probe:Drosophila_2:1631688_at:382:631; Interrogation_Position=3156; Antisense; TCTTGCCAGTGTCTTAAGCCTTTAA

Paste this into a BLAST search page for me
GACTGTGGATCGTTTTCGGGCAAATGGCAAATATCATCATCGACACGGGCTGAGGAGCTTACCTACAAGGCCCTGAATTTCAGGTGGAGGGTCCCTGCCAAGCGCTGCGACATGATCTGCATTAACGATTCGGCATCTACATCACTAGGAGGAGCAACACATGACCTGCGGCGATCTGCGGCGATGTTGTCCTTGTGGAAAAGCTCACTTTACATCACTTCAGCGACTTCAGCGTGGTTTTCTTCGTTCTTAATTCTCTATTACGTTGCATCACGCATCACGTTTCGCACTTAGTTTGTTAAAGTAACCGGATACCTCTTGCCAGTCTTGCCAGTGTCTTAAGCCTTTAA

Full Affymetrix probeset data:

Annotations for 1631688_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720