Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631689_at:

>probe:Drosophila_2:1631689_at:197:567; Interrogation_Position=2711; Antisense; GGCAGCGGCAGAATTCTTGTTTCCA
>probe:Drosophila_2:1631689_at:619:11; Interrogation_Position=2723; Antisense; ATTCTTGTTTCCACTCGAGATGCTG
>probe:Drosophila_2:1631689_at:190:375; Interrogation_Position=2779; Antisense; GAAGATGATCATCGCACTTTCTCGC
>probe:Drosophila_2:1631689_at:310:643; Interrogation_Position=2798; Antisense; TCTCGCTCGCTCTTGGAACAATGAA
>probe:Drosophila_2:1631689_at:457:389; Interrogation_Position=2851; Antisense; GAAAAAGCAGAACCATCCCGGCCAA
>probe:Drosophila_2:1631689_at:716:247; Interrogation_Position=2880; Antisense; AATTGAGCCGCCATCCGCTGATGAT
>probe:Drosophila_2:1631689_at:178:335; Interrogation_Position=2896; Antisense; GCTGATGATCATCGCTGGCCAAGTA
>probe:Drosophila_2:1631689_at:703:161; Interrogation_Position=2920; Antisense; ACAATTGCCACCATAAAGCCTCATC
>probe:Drosophila_2:1631689_at:457:455; Interrogation_Position=3057; Antisense; GATCAATGATCGCAATTCTCCGGTC
>probe:Drosophila_2:1631689_at:675:535; Interrogation_Position=3086; Antisense; GGTCTCTTCAGTACCTTCTTATGGA
>probe:Drosophila_2:1631689_at:316:643; Interrogation_Position=3102; Antisense; TCTTATGGACGCTTCAGACCCTGGA
>probe:Drosophila_2:1631689_at:476:407; Interrogation_Position=3141; Antisense; GACTGGCGATGCCACTTGTACACTT
>probe:Drosophila_2:1631689_at:177:599; Interrogation_Position=3157; Antisense; TGTACACTTGTTGCTGCGGGTCTGC
>probe:Drosophila_2:1631689_at:720:329; Interrogation_Position=3180; Antisense; GCGGTCGATCGCATTTCGGTTAATT

Paste this into a BLAST search page for me
GGCAGCGGCAGAATTCTTGTTTCCAATTCTTGTTTCCACTCGAGATGCTGGAAGATGATCATCGCACTTTCTCGCTCTCGCTCGCTCTTGGAACAATGAAGAAAAAGCAGAACCATCCCGGCCAAAATTGAGCCGCCATCCGCTGATGATGCTGATGATCATCGCTGGCCAAGTAACAATTGCCACCATAAAGCCTCATCGATCAATGATCGCAATTCTCCGGTCGGTCTCTTCAGTACCTTCTTATGGATCTTATGGACGCTTCAGACCCTGGAGACTGGCGATGCCACTTGTACACTTTGTACACTTGTTGCTGCGGGTCTGCGCGGTCGATCGCATTTCGGTTAATT

Full Affymetrix probeset data:

Annotations for 1631689_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime