FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631691_at:

>probe:Drosophila_2:1631691_at:705:163; Interrogation_Position=1019; Antisense; AAATCTCCGAGTCCAGATAGTCAAT
>probe:Drosophila_2:1631691_at:720:549; Interrogation_Position=558; Antisense; GGAGTGATATTCTCTGCCGCGGGAC
>probe:Drosophila_2:1631691_at:16:323; Interrogation_Position=611; Antisense; GCCCACTGCCAAAGATGCGGACAAG
>probe:Drosophila_2:1631691_at:423:367; Interrogation_Position=636; Antisense; GAATCGCCGGAGCTGTCTGGATATC
>probe:Drosophila_2:1631691_at:395:683; Interrogation_Position=666; Antisense; TATCCGACCTTCAGATCACCGTACT
>probe:Drosophila_2:1631691_at:662:491; Interrogation_Position=724; Antisense; GTAACTGGCCCAGCTTCCCAGGATA
>probe:Drosophila_2:1631691_at:241:455; Interrogation_Position=819; Antisense; GATAAGCCCAAGGACAAGTCTGGTG
>probe:Drosophila_2:1631691_at:301:571; Interrogation_Position=866; Antisense; GGCTCTGAAGCCACCAGGATTTAGC
>probe:Drosophila_2:1631691_at:145:79; Interrogation_Position=881; Antisense; AGGATTTAGCTACCCGCAGGTCTAT
>probe:Drosophila_2:1631691_at:141:349; Interrogation_Position=896; Antisense; GCAGGTCTATTTGATTCCCCGAAGA
>probe:Drosophila_2:1631691_at:730:375; Interrogation_Position=916; Antisense; GAAGACCAGTGATCTCTGTGCCCAG
>probe:Drosophila_2:1631691_at:721:263; Interrogation_Position=952; Antisense; CAGGAGGCGGATATGGTTCGCCCTA
>probe:Drosophila_2:1631691_at:148:669; Interrogation_Position=975; Antisense; TACGGCTACGGACTCTACTAACACT
>probe:Drosophila_2:1631691_at:452:143; Interrogation_Position=986; Antisense; ACTCTACTAACACTCTCCGATAAAT

Paste this into a BLAST search page for me
AAATCTCCGAGTCCAGATAGTCAATGGAGTGATATTCTCTGCCGCGGGACGCCCACTGCCAAAGATGCGGACAAGGAATCGCCGGAGCTGTCTGGATATCTATCCGACCTTCAGATCACCGTACTGTAACTGGCCCAGCTTCCCAGGATAGATAAGCCCAAGGACAAGTCTGGTGGGCTCTGAAGCCACCAGGATTTAGCAGGATTTAGCTACCCGCAGGTCTATGCAGGTCTATTTGATTCCCCGAAGAGAAGACCAGTGATCTCTGTGCCCAGCAGGAGGCGGATATGGTTCGCCCTATACGGCTACGGACTCTACTAACACTACTCTACTAACACTCTCCGATAAAT

Full Affymetrix probeset data:

Annotations for 1631691_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720