FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631692_at:

>probe:Drosophila_2:1631692_at:1:477; Interrogation_Position=1922; Antisense; GTTATATTGGCTCCCATCTTAGCAG
>probe:Drosophila_2:1631692_at:490:675; Interrogation_Position=1941; Antisense; TAGCAGCGTGCTGGTAACCGTCTCG
>probe:Drosophila_2:1631692_at:32:661; Interrogation_Position=1955; Antisense; TAACCGTCTCGCTATCTGTGATAAT
>probe:Drosophila_2:1631692_at:649:115; Interrogation_Position=1984; Antisense; AGCATTTGCATCGTTCTGCTGCAGC
>probe:Drosophila_2:1631692_at:202:177; Interrogation_Position=2072; Antisense; AAACGTTGCCGCGTGCACTGCAGCA
>probe:Drosophila_2:1631692_at:188:115; Interrogation_Position=2099; Antisense; AGCAGTACCAGTGCACCTTGTAGGT
>probe:Drosophila_2:1631692_at:600:683; Interrogation_Position=2189; Antisense; TATGCCCACTTGTCTTGCTGAATGT
>probe:Drosophila_2:1631692_at:288:283; Interrogation_Position=2249; Antisense; CTGAAGATGACTGCGCATAGCCACG
>probe:Drosophila_2:1631692_at:564:379; Interrogation_Position=2290; Antisense; GACCCTGGTTGAACGGATTCCAACT
>probe:Drosophila_2:1631692_at:442:305; Interrogation_Position=2318; Antisense; GCCCCATCGGTACCAGTGGGTTAAG
>probe:Drosophila_2:1631692_at:212:531; Interrogation_Position=2335; Antisense; GGGTTAAGCATCCTCCGATTTACAT
>probe:Drosophila_2:1631692_at:644:15; Interrogation_Position=2361; Antisense; ATTATAAGCTCGACTTCGGCTCTGG
>probe:Drosophila_2:1631692_at:535:311; Interrogation_Position=2385; Antisense; GCCAAGCTTTAACTGCGATCGCGAG
>probe:Drosophila_2:1631692_at:265:525; Interrogation_Position=2420; Antisense; GGGCATGGCACTTCTCATAGAGCGA

Paste this into a BLAST search page for me
GTTATATTGGCTCCCATCTTAGCAGTAGCAGCGTGCTGGTAACCGTCTCGTAACCGTCTCGCTATCTGTGATAATAGCATTTGCATCGTTCTGCTGCAGCAAACGTTGCCGCGTGCACTGCAGCAAGCAGTACCAGTGCACCTTGTAGGTTATGCCCACTTGTCTTGCTGAATGTCTGAAGATGACTGCGCATAGCCACGGACCCTGGTTGAACGGATTCCAACTGCCCCATCGGTACCAGTGGGTTAAGGGGTTAAGCATCCTCCGATTTACATATTATAAGCTCGACTTCGGCTCTGGGCCAAGCTTTAACTGCGATCGCGAGGGGCATGGCACTTCTCATAGAGCGA

Full Affymetrix probeset data:

Annotations for 1631692_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720