Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631693_at:

>probe:Drosophila_2:1631693_at:359:413; Interrogation_Position=129; Antisense; GACCTATATAGGCATTTTCTCGGCC
>probe:Drosophila_2:1631693_at:342:599; Interrogation_Position=14; Antisense; TGTCAATCACCTTGTTTGCGTTATT
>probe:Drosophila_2:1631693_at:344:697; Interrogation_Position=183; Antisense; TTTAAATTGGCTGGCGACATTCGAA
>probe:Drosophila_2:1631693_at:630:165; Interrogation_Position=216; Antisense; AAAGCGCGACTTGTTTGTGGGTTCA
>probe:Drosophila_2:1631693_at:72:541; Interrogation_Position=235; Antisense; GGTTCAATGAACACGTATCCCAATA
>probe:Drosophila_2:1631693_at:96:595; Interrogation_Position=264; Antisense; TGAGGCCGCCATTAACATTGTAAGG
>probe:Drosophila_2:1631693_at:630:315; Interrogation_Position=298; Antisense; GCCGAGGTTTTTGTGGAGTTCTTGA
>probe:Drosophila_2:1631693_at:536:429; Interrogation_Position=313; Antisense; GAGTTCTTGAACATCACCAACGCGC
>probe:Drosophila_2:1631693_at:114:483; Interrogation_Position=357; Antisense; GTATCTCAACGATCAACTACTCTGC
>probe:Drosophila_2:1631693_at:603:453; Interrogation_Position=367; Antisense; GATCAACTACTCTGCTCCAATGAAG
>probe:Drosophila_2:1631693_at:45:587; Interrogation_Position=38; Antisense; TGGTTCTATGTGCAGGCCCAACTTT
>probe:Drosophila_2:1631693_at:431:387; Interrogation_Position=402; Antisense; GAAAATTCGTATTTCTTGGGCATTT
>probe:Drosophila_2:1631693_at:507:111; Interrogation_Position=80; Antisense; AGCACTACTGCGATGAGCACTTCAG
>probe:Drosophila_2:1631693_at:102:421; Interrogation_Position=94; Antisense; GAGCACTTCAGATATGCCATGAAAG

Paste this into a BLAST search page for me
GACCTATATAGGCATTTTCTCGGCCTGTCAATCACCTTGTTTGCGTTATTTTTAAATTGGCTGGCGACATTCGAAAAAGCGCGACTTGTTTGTGGGTTCAGGTTCAATGAACACGTATCCCAATATGAGGCCGCCATTAACATTGTAAGGGCCGAGGTTTTTGTGGAGTTCTTGAGAGTTCTTGAACATCACCAACGCGCGTATCTCAACGATCAACTACTCTGCGATCAACTACTCTGCTCCAATGAAGTGGTTCTATGTGCAGGCCCAACTTTGAAAATTCGTATTTCTTGGGCATTTAGCACTACTGCGATGAGCACTTCAGGAGCACTTCAGATATGCCATGAAAG

Full Affymetrix probeset data:

Annotations for 1631693_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime