FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631695_at:

>probe:Drosophila_2:1631695_at:638:667; Interrogation_Position=109; Antisense; TACTCCACTCCACTGGCGTACAGCT
>probe:Drosophila_2:1631695_at:270:669; Interrogation_Position=193; Antisense; TACGTGGCCCCCTATGCCAGTAGCT
>probe:Drosophila_2:1631695_at:498:683; Interrogation_Position=205; Antisense; TATGCCAGTAGCTACAGTGCCCACA
>probe:Drosophila_2:1631695_at:18:49; Interrogation_Position=206; Antisense; ATGCCAGTAGCTACAGTGCCCACAG
>probe:Drosophila_2:1631695_at:663:313; Interrogation_Position=208; Antisense; GCCAGTAGCTACAGTGCCCACAGTG
>probe:Drosophila_2:1631695_at:209:89; Interrogation_Position=211; Antisense; AGTAGCTACAGTGCCCACAGTGTGG
>probe:Drosophila_2:1631695_at:708:339; Interrogation_Position=215; Antisense; GCTACAGTGCCCACAGTGTGGCCCA
>probe:Drosophila_2:1631695_at:64:285; Interrogation_Position=25; Antisense; CTGCAGTTTGCCGTTGTCCTGTGCG
>probe:Drosophila_2:1631695_at:329:595; Interrogation_Position=276; Antisense; TGTGGCCACCATCCTCAAGAAGTAA
>probe:Drosophila_2:1631695_at:23:93; Interrogation_Position=29; Antisense; AGTTTGCCGTTGTCCTGTGCGCCCT
>probe:Drosophila_2:1631695_at:656:721; Interrogation_Position=32; Antisense; TTGCCGTTGTCCTGTGCGCCCTGTT
>probe:Drosophila_2:1631695_at:619:619; Interrogation_Position=66; Antisense; TGCTGCCAATCCTGGTCTGCTGGCC
>probe:Drosophila_2:1631695_at:39:629; Interrogation_Position=69; Antisense; TGCCAATCCTGGTCTGCTGGCCTAC
>probe:Drosophila_2:1631695_at:522:621; Interrogation_Position=83; Antisense; TGCTGGCCTACAATGCCCCTCTGGC

Paste this into a BLAST search page for me
TACTCCACTCCACTGGCGTACAGCTTACGTGGCCCCCTATGCCAGTAGCTTATGCCAGTAGCTACAGTGCCCACAATGCCAGTAGCTACAGTGCCCACAGGCCAGTAGCTACAGTGCCCACAGTGAGTAGCTACAGTGCCCACAGTGTGGGCTACAGTGCCCACAGTGTGGCCCACTGCAGTTTGCCGTTGTCCTGTGCGTGTGGCCACCATCCTCAAGAAGTAAAGTTTGCCGTTGTCCTGTGCGCCCTTTGCCGTTGTCCTGTGCGCCCTGTTTGCTGCCAATCCTGGTCTGCTGGCCTGCCAATCCTGGTCTGCTGGCCTACTGCTGGCCTACAATGCCCCTCTGGC

Full Affymetrix probeset data:

Annotations for 1631695_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720