FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631699_at:

>probe:Drosophila_2:1631699_at:368:615; Interrogation_Position=1022; Antisense; TGCACTTACCAGATCGTCCATTTCG
>probe:Drosophila_2:1631699_at:495:503; Interrogation_Position=1058; Antisense; GTCCCAAGACTTTTCGGCTGAGCAG
>probe:Drosophila_2:1631699_at:393:573; Interrogation_Position=1073; Antisense; GGCTGAGCAGCACTCTCAAGGAGCA
>probe:Drosophila_2:1631699_at:291:553; Interrogation_Position=1092; Antisense; GGAGCACAAGCTCGTACACAACGCT
>probe:Drosophila_2:1631699_at:570:657; Interrogation_Position=1128; Antisense; TAAGTGTCCTCACTGTGCCAGTTTC
>probe:Drosophila_2:1631699_at:601:187; Interrogation_Position=1167; Antisense; AACACTTGCTAGACATATCCTCGAG
>probe:Drosophila_2:1631699_at:651:401; Interrogation_Position=1228; Antisense; GACATATCTTCCATGTGCACTACTT
>probe:Drosophila_2:1631699_at:702:13; Interrogation_Position=820; Antisense; ATTAAATCATCCGATCTCCGGCGTC
>probe:Drosophila_2:1631699_at:283:357; Interrogation_Position=851; Antisense; GCACACATGGCAGCGAGAGACCGTT
>probe:Drosophila_2:1631699_at:24:427; Interrogation_Position=865; Antisense; GAGAGACCGTTCAAGTGCTCCAAGT
>probe:Drosophila_2:1631699_at:478:435; Interrogation_Position=906; Antisense; GAGGAAGTTTCACCTTGATAACCAT
>probe:Drosophila_2:1631699_at:210:723; Interrogation_Position=920; Antisense; TTGATAACCATTTCCGTTCTCACAC
>probe:Drosophila_2:1631699_at:709:471; Interrogation_Position=935; Antisense; GTTCTCACACTGGTGAACGACCATT
>probe:Drosophila_2:1631699_at:493:225; Interrogation_Position=979; Antisense; AAGGCCTTCGCTATGAAGCAGCACC

Paste this into a BLAST search page for me
TGCACTTACCAGATCGTCCATTTCGGTCCCAAGACTTTTCGGCTGAGCAGGGCTGAGCAGCACTCTCAAGGAGCAGGAGCACAAGCTCGTACACAACGCTTAAGTGTCCTCACTGTGCCAGTTTCAACACTTGCTAGACATATCCTCGAGGACATATCTTCCATGTGCACTACTTATTAAATCATCCGATCTCCGGCGTCGCACACATGGCAGCGAGAGACCGTTGAGAGACCGTTCAAGTGCTCCAAGTGAGGAAGTTTCACCTTGATAACCATTTGATAACCATTTCCGTTCTCACACGTTCTCACACTGGTGAACGACCATTAAGGCCTTCGCTATGAAGCAGCACC

Full Affymetrix probeset data:

Annotations for 1631699_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720