Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631700_at:

>probe:Drosophila_2:1631700_at:402:695; Interrogation_Position=2617; Antisense; TTTCCGGTTCTATTGTAGGTGCAGG
>probe:Drosophila_2:1631700_at:516:601; Interrogation_Position=2630; Antisense; TGTAGGTGCAGGTGGATCTCAGTCT
>probe:Drosophila_2:1631700_at:239:619; Interrogation_Position=2636; Antisense; TGCAGGTGGATCTCAGTCTGATGAA
>probe:Drosophila_2:1631700_at:262:649; Interrogation_Position=2648; Antisense; TCAGTCTGATGAATCCTGGTCTCAA
>probe:Drosophila_2:1631700_at:422:445; Interrogation_Position=2655; Antisense; GATGAATCCTGGTCTCAACGTTCAG
>probe:Drosophila_2:1631700_at:588:521; Interrogation_Position=2665; Antisense; GGTCTCAACGTTCAGGATTCTCGGG
>probe:Drosophila_2:1631700_at:95:253; Interrogation_Position=2670; Antisense; CAACGTTCAGGATTCTCGGGTGACA
>probe:Drosophila_2:1631700_at:454:243; Interrogation_Position=3031; Antisense; AATATTAGAGTTGGTCCTTGCGAAT
>probe:Drosophila_2:1631700_at:231:531; Interrogation_Position=3043; Antisense; GGTCCTTGCGAATGGATAGGGCCCA
>probe:Drosophila_2:1631700_at:429:273; Interrogation_Position=3047; Antisense; CTTGCGAATGGATAGGGCCCAGATT
>probe:Drosophila_2:1631700_at:618:449; Interrogation_Position=3057; Antisense; GATAGGGCCCAGATTAAACGGCTCA
>probe:Drosophila_2:1631700_at:345:577; Interrogation_Position=3062; Antisense; GGCCCAGATTAAACGGCTCATGACT
>probe:Drosophila_2:1631700_at:453:177; Interrogation_Position=3072; Antisense; AAACGGCTCATGACTTTAATGTATA
>probe:Drosophila_2:1631700_at:262:571; Interrogation_Position=3076; Antisense; GGCTCATGACTTTAATGTATACGAT

Paste this into a BLAST search page for me
TTTCCGGTTCTATTGTAGGTGCAGGTGTAGGTGCAGGTGGATCTCAGTCTTGCAGGTGGATCTCAGTCTGATGAATCAGTCTGATGAATCCTGGTCTCAAGATGAATCCTGGTCTCAACGTTCAGGGTCTCAACGTTCAGGATTCTCGGGCAACGTTCAGGATTCTCGGGTGACAAATATTAGAGTTGGTCCTTGCGAATGGTCCTTGCGAATGGATAGGGCCCACTTGCGAATGGATAGGGCCCAGATTGATAGGGCCCAGATTAAACGGCTCAGGCCCAGATTAAACGGCTCATGACTAAACGGCTCATGACTTTAATGTATAGGCTCATGACTTTAATGTATACGAT

Full Affymetrix probeset data:

Annotations for 1631700_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime