FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631702_at:

>probe:Drosophila_2:1631702_at:187:185; Interrogation_Position=203; Antisense; AAAAGGAGCTCAACCAGCGGCTGGT
>probe:Drosophila_2:1631702_at:414:463; Interrogation_Position=242; Antisense; GATTCTTTAAGCATCGTGATCTCAA
>probe:Drosophila_2:1631702_at:290:653; Interrogation_Position=263; Antisense; TCAAGATGCATATCCTGCCCGGAAT
>probe:Drosophila_2:1631702_at:574:373; Interrogation_Position=294; Antisense; GAAGATTGTGCCCAGCAAGGACAAC
>probe:Drosophila_2:1631702_at:416:215; Interrogation_Position=325; Antisense; AAGTTCTCGATCAAGAAGGCACCCA
>probe:Drosophila_2:1631702_at:623:591; Interrogation_Position=359; Antisense; TGGGTCGTTCCCGAAGACGTGAGAC
>probe:Drosophila_2:1631702_at:698:373; Interrogation_Position=385; Antisense; GAAGAAATGGACCTGCCCCTTATTA
>probe:Drosophila_2:1631702_at:392:133; Interrogation_Position=401; Antisense; CCCTTATTAATATTCCGTCCATCGG
>probe:Drosophila_2:1631702_at:728:515; Interrogation_Position=449; Antisense; GTGTGGAGACCTACGAACCGGAAGC
>probe:Drosophila_2:1631702_at:124:211; Interrogation_Position=571; Antisense; AAGAACTCGTACAAGGTGACCATGA
>probe:Drosophila_2:1631702_at:247:129; Interrogation_Position=589; Antisense; ACCATGATGCAGGTGGCGGTGCCCA
>probe:Drosophila_2:1631702_at:607:333; Interrogation_Position=693; Antisense; GCTGGTGATGAACAATGGCGCCTTT
>probe:Drosophila_2:1631702_at:83:229; Interrogation_Position=706; Antisense; AATGGCGCCTTTATGGCAGCTTTAC
>probe:Drosophila_2:1631702_at:399:351; Interrogation_Position=721; Antisense; GCAGCTTTACTGTATGCCGCCCGTA

Paste this into a BLAST search page for me
AAAAGGAGCTCAACCAGCGGCTGGTGATTCTTTAAGCATCGTGATCTCAATCAAGATGCATATCCTGCCCGGAATGAAGATTGTGCCCAGCAAGGACAACAAGTTCTCGATCAAGAAGGCACCCATGGGTCGTTCCCGAAGACGTGAGACGAAGAAATGGACCTGCCCCTTATTACCCTTATTAATATTCCGTCCATCGGGTGTGGAGACCTACGAACCGGAAGCAAGAACTCGTACAAGGTGACCATGAACCATGATGCAGGTGGCGGTGCCCAGCTGGTGATGAACAATGGCGCCTTTAATGGCGCCTTTATGGCAGCTTTACGCAGCTTTACTGTATGCCGCCCGTA

Full Affymetrix probeset data:

Annotations for 1631702_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720