FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631704_at:

>probe:Drosophila_2:1631704_at:685:93; Interrogation_Position=1533; Antisense; AGTTGAATTGCCGACGATAGCGAAT
>probe:Drosophila_2:1631704_at:556:683; Interrogation_Position=1558; Antisense; TATAAATCATCGATGGCGGACGCAT
>probe:Drosophila_2:1631704_at:570:369; Interrogation_Position=1601; Antisense; GAATGTTGCAACATACTTGCGGCTA
>probe:Drosophila_2:1631704_at:661:571; Interrogation_Position=1621; Antisense; GGCTAGGATGTTCAAGTAACGCAAT
>probe:Drosophila_2:1631704_at:103:345; Interrogation_Position=1653; Antisense; GCAAATACCCCAAAGTGTTGTAGCT
>probe:Drosophila_2:1631704_at:54:679; Interrogation_Position=1705; Antisense; TAGTCGTTTTATACCTAACACGCGA
>probe:Drosophila_2:1631704_at:726:439; Interrogation_Position=1731; Antisense; GAGGCCGATCGGTGACAAGCATAAT
>probe:Drosophila_2:1631704_at:93:141; Interrogation_Position=1815; Antisense; ACTGTTGATTACATTGGTAGCCCAA
>probe:Drosophila_2:1631704_at:713:587; Interrogation_Position=1829; Antisense; TGGTAGCCCAATTACTTTTACACAA
>probe:Drosophila_2:1631704_at:222:113; Interrogation_Position=1857; Antisense; AGCACAGCAATGTTTGCGCCAAACA
>probe:Drosophila_2:1631704_at:416:121; Interrogation_Position=1886; Antisense; ACCACAAACTGGACATGCCGAATTA
>probe:Drosophila_2:1631704_at:641:609; Interrogation_Position=1916; Antisense; TAATATCGAAACAGGGTCGCCCCTC
>probe:Drosophila_2:1631704_at:364:501; Interrogation_Position=1948; Antisense; GTCGGGAGGCACTACACTTAGCTAA
>probe:Drosophila_2:1631704_at:631:11; Interrogation_Position=1975; Antisense; ATTCGTGTGTGTGTGTTCTCTGAGT

Paste this into a BLAST search page for me
AGTTGAATTGCCGACGATAGCGAATTATAAATCATCGATGGCGGACGCATGAATGTTGCAACATACTTGCGGCTAGGCTAGGATGTTCAAGTAACGCAATGCAAATACCCCAAAGTGTTGTAGCTTAGTCGTTTTATACCTAACACGCGAGAGGCCGATCGGTGACAAGCATAATACTGTTGATTACATTGGTAGCCCAATGGTAGCCCAATTACTTTTACACAAAGCACAGCAATGTTTGCGCCAAACAACCACAAACTGGACATGCCGAATTATAATATCGAAACAGGGTCGCCCCTCGTCGGGAGGCACTACACTTAGCTAAATTCGTGTGTGTGTGTTCTCTGAGT

Full Affymetrix probeset data:

Annotations for 1631704_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720