FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631706_at:

>probe:Drosophila_2:1631706_at:687:595; Interrogation_Position=423; Antisense; TGTGGAGATTCTTTGGCAGCGCGTC
>probe:Drosophila_2:1631706_at:341:609; Interrogation_Position=489; Antisense; TGAGCTGAAACTGCGCAACTTGATT
>probe:Drosophila_2:1631706_at:362:721; Interrogation_Position=512; Antisense; TTGAGAACAGGTGCCAAGCCCACAA
>probe:Drosophila_2:1631706_at:64:205; Interrogation_Position=527; Antisense; AAGCCCACAATCTAGACACTGATCG
>probe:Drosophila_2:1631706_at:385:107; Interrogation_Position=557; Antisense; AGAAGGCCCAGTTCGCCAAGGAGGT
>probe:Drosophila_2:1631706_at:225:69; Interrogation_Position=608; Antisense; AGGCCCTGGAACTGGCTGCCGAAAT
>probe:Drosophila_2:1631706_at:551:311; Interrogation_Position=683; Antisense; GCCAGCAGCTCATTGACTTGCAGGA
>probe:Drosophila_2:1631706_at:105:239; Interrogation_Position=721; Antisense; AATCTTACCATCAGCGCTCGGCAAG
>probe:Drosophila_2:1631706_at:721:111; Interrogation_Position=744; Antisense; AGCACAGGCCAATATCCGTGAGGAT
>probe:Drosophila_2:1631706_at:347:303; Interrogation_Position=792; Antisense; CCGCCAGATTTACGAGGAGCTCATG
>probe:Drosophila_2:1631706_at:128:379; Interrogation_Position=819; Antisense; GAAGCGTTGCGCCAGGATTCACAAT
>probe:Drosophila_2:1631706_at:106:237; Interrogation_Position=841; Antisense; AATCGCGATTGGCACCAGCAGTACA
>probe:Drosophila_2:1631706_at:276:89; Interrogation_Position=860; Antisense; AGTACATGACGCACACGGCTGCCGA
>probe:Drosophila_2:1631706_at:137:139; Interrogation_Position=915; Antisense; ACGGGATCGGAAATACCTGGGCACT

Paste this into a BLAST search page for me
TGTGGAGATTCTTTGGCAGCGCGTCTGAGCTGAAACTGCGCAACTTGATTTTGAGAACAGGTGCCAAGCCCACAAAAGCCCACAATCTAGACACTGATCGAGAAGGCCCAGTTCGCCAAGGAGGTAGGCCCTGGAACTGGCTGCCGAAATGCCAGCAGCTCATTGACTTGCAGGAAATCTTACCATCAGCGCTCGGCAAGAGCACAGGCCAATATCCGTGAGGATCCGCCAGATTTACGAGGAGCTCATGGAAGCGTTGCGCCAGGATTCACAATAATCGCGATTGGCACCAGCAGTACAAGTACATGACGCACACGGCTGCCGAACGGGATCGGAAATACCTGGGCACT

Full Affymetrix probeset data:

Annotations for 1631706_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720