FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631707_at:

>probe:Drosophila_2:1631707_at:169:539; Interrogation_Position=1000; Antisense; GGTACCTGATAAAACGTTCTCTTAT
>probe:Drosophila_2:1631707_at:340:471; Interrogation_Position=1015; Antisense; GTTCTCTTATGTCTGCGTTAGCTAT
>probe:Drosophila_2:1631707_at:418:649; Interrogation_Position=1053; Antisense; TAAAGCTAGGACTCTTGCGTTTTAA
>probe:Drosophila_2:1631707_at:399:529; Interrogation_Position=1087; Antisense; GGGTTTTCCTTATCGATATCTAATC
>probe:Drosophila_2:1631707_at:41:429; Interrogation_Position=1119; Antisense; GAGATATCGCTCGACAATCGCACGA
>probe:Drosophila_2:1631707_at:564:213; Interrogation_Position=1149; Antisense; AAGATGCGCAACGTCCATAGATTCG
>probe:Drosophila_2:1631707_at:220:307; Interrogation_Position=1163; Antisense; CCATAGATTCGTTTTGCAGTAAGCA
>probe:Drosophila_2:1631707_at:590:533; Interrogation_Position=1240; Antisense; GGTGTGGAAAGCCATCGTTTCGCCT
>probe:Drosophila_2:1631707_at:73:479; Interrogation_Position=1256; Antisense; GTTTCGCCTCGCAAGCAGTTGAGAT
>probe:Drosophila_2:1631707_at:679:7; Interrogation_Position=1374; Antisense; ATTAGTCCGCTTTAATAAATCCCAG
>probe:Drosophila_2:1631707_at:395:443; Interrogation_Position=914; Antisense; GATGTTATTATTTTTCTAGCTTCGA
>probe:Drosophila_2:1631707_at:74:645; Interrogation_Position=928; Antisense; TCTAGCTTCGATCATGTTGCCAAAA
>probe:Drosophila_2:1631707_at:381:705; Interrogation_Position=960; Antisense; TTAATTTCTCCCTTGCAAACCCACT
>probe:Drosophila_2:1631707_at:676:175; Interrogation_Position=976; Antisense; AAACCCACTTGCTGCTGAGTAACGG

Paste this into a BLAST search page for me
GGTACCTGATAAAACGTTCTCTTATGTTCTCTTATGTCTGCGTTAGCTATTAAAGCTAGGACTCTTGCGTTTTAAGGGTTTTCCTTATCGATATCTAATCGAGATATCGCTCGACAATCGCACGAAAGATGCGCAACGTCCATAGATTCGCCATAGATTCGTTTTGCAGTAAGCAGGTGTGGAAAGCCATCGTTTCGCCTGTTTCGCCTCGCAAGCAGTTGAGATATTAGTCCGCTTTAATAAATCCCAGGATGTTATTATTTTTCTAGCTTCGATCTAGCTTCGATCATGTTGCCAAAATTAATTTCTCCCTTGCAAACCCACTAAACCCACTTGCTGCTGAGTAACGG

Full Affymetrix probeset data:

Annotations for 1631707_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720