FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631709_at:

>probe:Drosophila_2:1631709_at:133:339; Interrogation_Position=167; Antisense; GCTACAACTTCAGCGAGTACACGTT
>probe:Drosophila_2:1631709_at:90:711; Interrogation_Position=191; Antisense; TTAAGAACTTCGAGCTCTTCCTCTA
>probe:Drosophila_2:1631709_at:408:431; Interrogation_Position=300; Antisense; GAGTCCGGACTACAATGCCTACGAG
>probe:Drosophila_2:1631709_at:407:671; Interrogation_Position=319; Antisense; TACGAGAAGGCGCTGCAGTGCACCA
>probe:Drosophila_2:1631709_at:527:525; Interrogation_Position=384; Antisense; GGGAATACCTTGTGCCGCCTACATT
>probe:Drosophila_2:1631709_at:7:445; Interrogation_Position=414; Antisense; GATGAATCACCACACGATGCCAAAG
>probe:Drosophila_2:1631709_at:191:443; Interrogation_Position=438; Antisense; GTTCGGCTTTGGACCGTACAAGAAG
>probe:Drosophila_2:1631709_at:512:109; Interrogation_Position=458; Antisense; AGAAGACCGGCAGCGTGAGCAGCTT
>probe:Drosophila_2:1631709_at:521:609; Interrogation_Position=473; Antisense; TGAGCAGCTTTTTTCTGCCCAAGAT
>probe:Drosophila_2:1631709_at:86:121; Interrogation_Position=550; Antisense; AGCGGTAGCCGCTGTAACCACAAGG
>probe:Drosophila_2:1631709_at:324:583; Interrogation_Position=575; Antisense; TGGCTCTGGAATTGTCGCACGGCAA
>probe:Drosophila_2:1631709_at:460:117; Interrogation_Position=608; Antisense; AGCTAATTTCACTGCCCGCGGAAAA
>probe:Drosophila_2:1631709_at:77:139; Interrogation_Position=661; Antisense; ACGTTCACAGTGAAGGACTCCTCGG
>probe:Drosophila_2:1631709_at:305:35; Interrogation_Position=713; Antisense; ATCAGCAGCAGTGCGGCAATTCAGC

Paste this into a BLAST search page for me
GCTACAACTTCAGCGAGTACACGTTTTAAGAACTTCGAGCTCTTCCTCTAGAGTCCGGACTACAATGCCTACGAGTACGAGAAGGCGCTGCAGTGCACCAGGGAATACCTTGTGCCGCCTACATTGATGAATCACCACACGATGCCAAAGGTTCGGCTTTGGACCGTACAAGAAGAGAAGACCGGCAGCGTGAGCAGCTTTGAGCAGCTTTTTTCTGCCCAAGATAGCGGTAGCCGCTGTAACCACAAGGTGGCTCTGGAATTGTCGCACGGCAAAGCTAATTTCACTGCCCGCGGAAAAACGTTCACAGTGAAGGACTCCTCGGATCAGCAGCAGTGCGGCAATTCAGC

Full Affymetrix probeset data:

Annotations for 1631709_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720