Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631710_at:

>probe:Drosophila_2:1631710_at:512:729; Interrogation_Position=2543; Antisense; TTGGAGCCGGTGTTTGCAGTGCAAA
>probe:Drosophila_2:1631710_at:673:205; Interrogation_Position=2568; Antisense; AAGCGATGATGATGGCCCTTCTGAG
>probe:Drosophila_2:1631710_at:662:301; Interrogation_Position=2583; Antisense; CCCTTCTGAGTTGGGCGTAGACAAT
>probe:Drosophila_2:1631710_at:204:41; Interrogation_Position=2606; Antisense; ATCTGAGTGGCATCTACGTTGTCTT
>probe:Drosophila_2:1631710_at:293:671; Interrogation_Position=2620; Antisense; TACGTTGTCTTGGTCATCGGATCCA
>probe:Drosophila_2:1631710_at:671:639; Interrogation_Position=2667; Antisense; TCTATGTTGGTGCTACTTTGTCTAC
>probe:Drosophila_2:1631710_at:208:681; Interrogation_Position=2707; Antisense; TATGAGGTACCCTTTTGCGATGCCT
>probe:Drosophila_2:1631710_at:640:447; Interrogation_Position=2725; Antisense; GATGCCTTGGCTGAGGAATTCCGAA
>probe:Drosophila_2:1631710_at:244:363; Interrogation_Position=2740; Antisense; GAATTCCGAATCGTCATCCGCTTTT
>probe:Drosophila_2:1631710_at:303:393; Interrogation_Position=2773; Antisense; GAAAGACCTCTAAAGAGCGCCCAGT
>probe:Drosophila_2:1631710_at:463:87; Interrogation_Position=2795; Antisense; AGTCCATATACTCTCGCAGTCGGAA
>probe:Drosophila_2:1631710_at:323:349; Interrogation_Position=2810; Antisense; GCAGTCGGAATTCATCTCAGTCCAT
>probe:Drosophila_2:1631710_at:704:427; Interrogation_Position=2888; Antisense; GAGATATTCTCTCCAAAGTTTCGAA
>probe:Drosophila_2:1631710_at:660:173; Interrogation_Position=2913; Antisense; AAAGCTCTCCATAATTTCACTCAAA

Paste this into a BLAST search page for me
TTGGAGCCGGTGTTTGCAGTGCAAAAAGCGATGATGATGGCCCTTCTGAGCCCTTCTGAGTTGGGCGTAGACAATATCTGAGTGGCATCTACGTTGTCTTTACGTTGTCTTGGTCATCGGATCCATCTATGTTGGTGCTACTTTGTCTACTATGAGGTACCCTTTTGCGATGCCTGATGCCTTGGCTGAGGAATTCCGAAGAATTCCGAATCGTCATCCGCTTTTGAAAGACCTCTAAAGAGCGCCCAGTAGTCCATATACTCTCGCAGTCGGAAGCAGTCGGAATTCATCTCAGTCCATGAGATATTCTCTCCAAAGTTTCGAAAAAGCTCTCCATAATTTCACTCAAA

Full Affymetrix probeset data:

Annotations for 1631710_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime