FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631711_at:

>probe:Drosophila_2:1631711_at:51:147; Interrogation_Position=521; Antisense; ACTATGCAACGCGTGAGTTGTTTTT
>probe:Drosophila_2:1631711_at:292:135; Interrogation_Position=529; Antisense; ACGCGTGAGTTGTTTTTATTGTATA
>probe:Drosophila_2:1631711_at:559:243; Interrogation_Position=559; Antisense; AATTTTAATCGATCATTTCAATAAG
>probe:Drosophila_2:1631711_at:128:453; Interrogation_Position=569; Antisense; GATCATTTCAATAAGTGACAGTCAT
>probe:Drosophila_2:1631711_at:571:657; Interrogation_Position=580; Antisense; TAAGTGACAGTCATCGACAGTATGT
>probe:Drosophila_2:1631711_at:208:401; Interrogation_Position=585; Antisense; GACAGTCATCGACAGTATGTCAAGC
>probe:Drosophila_2:1631711_at:506:497; Interrogation_Position=589; Antisense; GTCATCGACAGTATGTCAAGCACGT
>probe:Drosophila_2:1631711_at:39:295; Interrogation_Position=594; Antisense; CGACAGTATGTCAAGCACGTAAAAG
>probe:Drosophila_2:1631711_at:390:265; Interrogation_Position=597; Antisense; CAGTATGTCAAGCACGTAAAAGTTT
>probe:Drosophila_2:1631711_at:181:495; Interrogation_Position=603; Antisense; GTCAAGCACGTAAAAGTTTGAGATT
>probe:Drosophila_2:1631711_at:150:165; Interrogation_Position=642; Antisense; AAATACACATCTGCTAAAGTTTGCC
>probe:Drosophila_2:1631711_at:575:665; Interrogation_Position=645; Antisense; TACACATCTGCTAAAGTTTGCCAGC
>probe:Drosophila_2:1631711_at:6:41; Interrogation_Position=650; Antisense; ATCTGCTAAAGTTTGCCAGCATTCA
>probe:Drosophila_2:1631711_at:145:627; Interrogation_Position=663; Antisense; TGCCAGCATTCAATATAGATTTATA

Paste this into a BLAST search page for me
ACTATGCAACGCGTGAGTTGTTTTTACGCGTGAGTTGTTTTTATTGTATAAATTTTAATCGATCATTTCAATAAGGATCATTTCAATAAGTGACAGTCATTAAGTGACAGTCATCGACAGTATGTGACAGTCATCGACAGTATGTCAAGCGTCATCGACAGTATGTCAAGCACGTCGACAGTATGTCAAGCACGTAAAAGCAGTATGTCAAGCACGTAAAAGTTTGTCAAGCACGTAAAAGTTTGAGATTAAATACACATCTGCTAAAGTTTGCCTACACATCTGCTAAAGTTTGCCAGCATCTGCTAAAGTTTGCCAGCATTCATGCCAGCATTCAATATAGATTTATA

Full Affymetrix probeset data:

Annotations for 1631711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720