Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631712_at:

>probe:Drosophila_2:1631712_at:323:491; Interrogation_Position=2211; Antisense; GTAACTTTCCTACTATTTTCAATGG
>probe:Drosophila_2:1631712_at:701:611; Interrogation_Position=2260; Antisense; TGAAATGGATCTCTCTCGGATTGGG
>probe:Drosophila_2:1631712_at:331:257; Interrogation_Position=2321; Antisense; CACAACGAATTTACTGCACGAGATT
>probe:Drosophila_2:1631712_at:234:215; Interrogation_Position=2380; Antisense; AAGATATGTTTGCTTCCAACTGCGC
>probe:Drosophila_2:1631712_at:691:653; Interrogation_Position=2436; Antisense; TAACCAGGTTGTTTTTTGTAGTCAG
>probe:Drosophila_2:1631712_at:374:489; Interrogation_Position=2460; Antisense; GTACAGTAAACTCACACAGCCAAAA
>probe:Drosophila_2:1631712_at:692:613; Interrogation_Position=2503; Antisense; TGAATTGCATACGTACATAACTTGT
>probe:Drosophila_2:1631712_at:369:605; Interrogation_Position=2567; Antisense; TGATTTGTGTAATTGCCAGCGGCTG
>probe:Drosophila_2:1631712_at:534:313; Interrogation_Position=2581; Antisense; GCCAGCGGCTGTTTAGAGCTAGTCA
>probe:Drosophila_2:1631712_at:57:419; Interrogation_Position=2596; Antisense; GAGCTAGTCATTTTTGATTTTGTGC
>probe:Drosophila_2:1631712_at:84:675; Interrogation_Position=2688; Antisense; TAGCTCATAAGCACCAGAAGATACA
>probe:Drosophila_2:1631712_at:514:371; Interrogation_Position=2704; Antisense; GAAGATACATCATCGACGTACACGT
>probe:Drosophila_2:1631712_at:459:489; Interrogation_Position=2721; Antisense; GTACACGTACGTTTGTTGTTGGCCA
>probe:Drosophila_2:1631712_at:541:465; Interrogation_Position=2738; Antisense; GTTGGCCAAGGCTTTGAAATTGTAT

Paste this into a BLAST search page for me
GTAACTTTCCTACTATTTTCAATGGTGAAATGGATCTCTCTCGGATTGGGCACAACGAATTTACTGCACGAGATTAAGATATGTTTGCTTCCAACTGCGCTAACCAGGTTGTTTTTTGTAGTCAGGTACAGTAAACTCACACAGCCAAAATGAATTGCATACGTACATAACTTGTTGATTTGTGTAATTGCCAGCGGCTGGCCAGCGGCTGTTTAGAGCTAGTCAGAGCTAGTCATTTTTGATTTTGTGCTAGCTCATAAGCACCAGAAGATACAGAAGATACATCATCGACGTACACGTGTACACGTACGTTTGTTGTTGGCCAGTTGGCCAAGGCTTTGAAATTGTAT

Full Affymetrix probeset data:

Annotations for 1631712_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime