FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631716_at:

>probe:Drosophila_2:1631716_at:13:141; Interrogation_Position=137; Antisense; ACGTGTTCTGCGAGCGGTGCGTCAA
>probe:Drosophila_2:1631716_at:269:123; Interrogation_Position=184; Antisense; AGCGACGCGCCCATATTCGAATGCT
>probe:Drosophila_2:1631716_at:575:715; Interrogation_Position=199; Antisense; TTCGAATGCTCCACCTGTCGGCGGA
>probe:Drosophila_2:1631716_at:336:129; Interrogation_Position=295; Antisense; ACCATCGGCAACGACTTTGTGGAGA
>probe:Drosophila_2:1631716_at:678:551; Interrogation_Position=315; Antisense; GGAGACGTTCCAGCGCGGCAATCAT
>probe:Drosophila_2:1631716_at:536:239; Interrogation_Position=334; Antisense; AATCATCGGCACTTCGACAAGTACA
>probe:Drosophila_2:1631716_at:409:117; Interrogation_Position=386; Antisense; AGCTGTTCAAGGACATCGAGGTGGC
>probe:Drosophila_2:1631716_at:670:217; Interrogation_Position=412; Antisense; AAGTCCGTGTGCCAGAAACGCTTCC
>probe:Drosophila_2:1631716_at:532:391; Interrogation_Position=426; Antisense; GAAACGCTTCCTGGAGGCGCAGATG
>probe:Drosophila_2:1631716_at:31:121; Interrogation_Position=470; Antisense; AGCTGATGCAGAGGTCGCGCTACAT
>probe:Drosophila_2:1631716_at:168:265; Interrogation_Position=603; Antisense; CGGACGTCCTCGTGGCCGTGGAACA
>probe:Drosophila_2:1631716_at:721:61; Interrogation_Position=643; Antisense; AGTCGACGCCGATCAACGGAATCAG
>probe:Drosophila_2:1631716_at:1:333; Interrogation_Position=672; Antisense; GCGGCAGCAAATCACCAGCTTCATA
>probe:Drosophila_2:1631716_at:102:387; Interrogation_Position=705; Antisense; GAACAACTCGTTCGATCTGTGAGCT

Paste this into a BLAST search page for me
ACGTGTTCTGCGAGCGGTGCGTCAAAGCGACGCGCCCATATTCGAATGCTTTCGAATGCTCCACCTGTCGGCGGAACCATCGGCAACGACTTTGTGGAGAGGAGACGTTCCAGCGCGGCAATCATAATCATCGGCACTTCGACAAGTACAAGCTGTTCAAGGACATCGAGGTGGCAAGTCCGTGTGCCAGAAACGCTTCCGAAACGCTTCCTGGAGGCGCAGATGAGCTGATGCAGAGGTCGCGCTACATCGGACGTCCTCGTGGCCGTGGAACAAGTCGACGCCGATCAACGGAATCAGGCGGCAGCAAATCACCAGCTTCATAGAACAACTCGTTCGATCTGTGAGCT

Full Affymetrix probeset data:

Annotations for 1631716_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720