FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631718_at:

>probe:Drosophila_2:1631718_at:8:87; Interrogation_Position=153; Antisense; AGTGCAGCTGCATCGCATGTACAGT
>probe:Drosophila_2:1631718_at:637:329; Interrogation_Position=202; Antisense; TCGGGTGCGGAAAAACTGGTGCCTC
>probe:Drosophila_2:1631718_at:566:235; Interrogation_Position=256; Antisense; AATCCCAAACTGGACTCGATTGTCA
>probe:Drosophila_2:1631718_at:477:465; Interrogation_Position=273; Antisense; GATTGTCAACAACATTGCCGCGCTC
>probe:Drosophila_2:1631718_at:215:179; Interrogation_Position=334; Antisense; AAACAGAAACTGAACCTGCCCGAGA
>probe:Drosophila_2:1631718_at:129:439; Interrogation_Position=421; Antisense; GAGGCAGCGCCCAAGAAGGTACAGA
>probe:Drosophila_2:1631718_at:13:537; Interrogation_Position=438; Antisense; GGTACAGACCTCCTTCAAGGTCAAG
>probe:Drosophila_2:1631718_at:653:377; Interrogation_Position=513; Antisense; GAACCTACTCGAGGGCATGAACCTG
>probe:Drosophila_2:1631718_at:411:181; Interrogation_Position=547; Antisense; AAAAAGTTCGTCGAGAGCGCACCGA
>probe:Drosophila_2:1631718_at:197:415; Interrogation_Position=561; Antisense; GAGCGCACCGACCATCGTTAAGGAG
>probe:Drosophila_2:1631718_at:182:391; Interrogation_Position=609; Antisense; GAAACTCAAGGAGGCACTGTCCAAG
>probe:Drosophila_2:1631718_at:72:331; Interrogation_Position=634; Antisense; GCGGGCGCCATCATCGAGATCGAGT
>probe:Drosophila_2:1631718_at:503:139; Interrogation_Position=669; Antisense; ACGGTGCCTTCGTTTATCCACTTTG
>probe:Drosophila_2:1631718_at:106:49; Interrogation_Position=684; Antisense; ATCCACTTTGCGTTTAGCTGCTAGT

Paste this into a BLAST search page for me
AGTGCAGCTGCATCGCATGTACAGTTCGGGTGCGGAAAAACTGGTGCCTCAATCCCAAACTGGACTCGATTGTCAGATTGTCAACAACATTGCCGCGCTCAAACAGAAACTGAACCTGCCCGAGAGAGGCAGCGCCCAAGAAGGTACAGAGGTACAGACCTCCTTCAAGGTCAAGGAACCTACTCGAGGGCATGAACCTGAAAAAGTTCGTCGAGAGCGCACCGAGAGCGCACCGACCATCGTTAAGGAGGAAACTCAAGGAGGCACTGTCCAAGGCGGGCGCCATCATCGAGATCGAGTACGGTGCCTTCGTTTATCCACTTTGATCCACTTTGCGTTTAGCTGCTAGT

Full Affymetrix probeset data:

Annotations for 1631718_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720