FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631719_at:

>probe:Drosophila_2:1631719_at:199:643; Interrogation_Position=295; Antisense; TCTCCGACTGATCCATTGCCAAAAA
>probe:Drosophila_2:1631719_at:235:617; Interrogation_Position=325; Antisense; TGCAAATCATGTCTGCATCGCGTGG
>probe:Drosophila_2:1631719_at:471:45; Interrogation_Position=341; Antisense; ATCGCGTGGAGCAGCATTACTCGCT
>probe:Drosophila_2:1631719_at:447:211; Interrogation_Position=429; Antisense; AAGAAATCCCTCGATATCCAGCGTG
>probe:Drosophila_2:1631719_at:328:57; Interrogation_Position=509; Antisense; ATGAGGAGGATCAAGCGACCCGCCG
>probe:Drosophila_2:1631719_at:727:431; Interrogation_Position=538; Antisense; GAGTCGACGAGCACCCAAGCTGAAA
>probe:Drosophila_2:1631719_at:148:391; Interrogation_Position=559; Antisense; GAAACTGGTCCACAGACCCAGGAAT
>probe:Drosophila_2:1631719_at:123:517; Interrogation_Position=613; Antisense; GTGTCCACACCAAACAGCAGCGAAA
>probe:Drosophila_2:1631719_at:457:333; Interrogation_Position=655; Antisense; GCTGGGCCCAGCAATAGAGACCGAA
>probe:Drosophila_2:1631719_at:499:405; Interrogation_Position=684; Antisense; GACTGGCACAGGCAACTCGGAAACG
>probe:Drosophila_2:1631719_at:120:525; Interrogation_Position=722; Antisense; GGGAAGGAACCCATGCAGATTAATA
>probe:Drosophila_2:1631719_at:348:13; Interrogation_Position=740; Antisense; ATTAATAACTGCTAACCTCGTCTCT
>probe:Drosophila_2:1631719_at:25:293; Interrogation_Position=758; Antisense; CGTCTCTGGTCGGTGGAGCTATATA
>probe:Drosophila_2:1631719_at:563:409; Interrogation_Position=811; Antisense; GACGCGTTTGTGTGTACGTACGTTT

Paste this into a BLAST search page for me
TCTCCGACTGATCCATTGCCAAAAATGCAAATCATGTCTGCATCGCGTGGATCGCGTGGAGCAGCATTACTCGCTAAGAAATCCCTCGATATCCAGCGTGATGAGGAGGATCAAGCGACCCGCCGGAGTCGACGAGCACCCAAGCTGAAAGAAACTGGTCCACAGACCCAGGAATGTGTCCACACCAAACAGCAGCGAAAGCTGGGCCCAGCAATAGAGACCGAAGACTGGCACAGGCAACTCGGAAACGGGGAAGGAACCCATGCAGATTAATAATTAATAACTGCTAACCTCGTCTCTCGTCTCTGGTCGGTGGAGCTATATAGACGCGTTTGTGTGTACGTACGTTT

Full Affymetrix probeset data:

Annotations for 1631719_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720