Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631721_at:

>probe:Drosophila_2:1631721_at:10:657; Interrogation_Position=1008; Antisense; TAATGTCGCACATGAGTTCCCACGG
>probe:Drosophila_2:1631721_at:680:259; Interrogation_Position=1028; Antisense; CACGGCCTCTTTTCTGGATTCAAAA
>probe:Drosophila_2:1631721_at:357:255; Interrogation_Position=1054; Antisense; CAAAGTGCCGTCTACCCAACAGGAA
>probe:Drosophila_2:1631721_at:228:73; Interrogation_Position=1074; Antisense; AGGAACGACGTCTTCTGGAGGGCAA
>probe:Drosophila_2:1631721_at:58:565; Interrogation_Position=1094; Antisense; GGCAAGTTTATGACGCTGGACCCCA
>probe:Drosophila_2:1631721_at:277:539; Interrogation_Position=1126; Antisense; GGTTGAACCCGATCGCCGAAAGTTG
>probe:Drosophila_2:1631721_at:615:449; Interrogation_Position=1136; Antisense; GATCGCCGAAAGTTGCCATACCGCA
>probe:Drosophila_2:1631721_at:355:671; Interrogation_Position=1172; Antisense; TACGCTAAGGCAGATTTCCCGGAAT
>probe:Drosophila_2:1631721_at:631:365; Interrogation_Position=1193; Antisense; GAATCCCCGACGAAATGTACCAACG
>probe:Drosophila_2:1631721_at:466:549; Interrogation_Position=1217; Antisense; GGAGGAGAGTTCATCAGCCTGCCCA
>probe:Drosophila_2:1631721_at:425:125; Interrogation_Position=1232; Antisense; AGCCTGCCCAAGAAAATTTCCCTGC
>probe:Drosophila_2:1631721_at:205:693; Interrogation_Position=1278; Antisense; TTTCGGACAATTCAAGACCTTAGTT
>probe:Drosophila_2:1631721_at:29:289; Interrogation_Position=1492; Antisense; CGTTTTATAATTTCTCTTCGTGGAT
>probe:Drosophila_2:1631721_at:10:93; Interrogation_Position=986; Antisense; AGTTATCGAGTGTGGGCGCGCTTAA

Paste this into a BLAST search page for me
TAATGTCGCACATGAGTTCCCACGGCACGGCCTCTTTTCTGGATTCAAAACAAAGTGCCGTCTACCCAACAGGAAAGGAACGACGTCTTCTGGAGGGCAAGGCAAGTTTATGACGCTGGACCCCAGGTTGAACCCGATCGCCGAAAGTTGGATCGCCGAAAGTTGCCATACCGCATACGCTAAGGCAGATTTCCCGGAATGAATCCCCGACGAAATGTACCAACGGGAGGAGAGTTCATCAGCCTGCCCAAGCCTGCCCAAGAAAATTTCCCTGCTTTCGGACAATTCAAGACCTTAGTTCGTTTTATAATTTCTCTTCGTGGATAGTTATCGAGTGTGGGCGCGCTTAA

Full Affymetrix probeset data:

Annotations for 1631721_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime