FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631723_at:

>probe:Drosophila_2:1631723_at:497:187; Interrogation_Position=1008; Antisense; AACATCGAATCTCTTCTGTCCAGTG
>probe:Drosophila_2:1631723_at:375:597; Interrogation_Position=1024; Antisense; TGTCCAGTGTGGATGAGGCCCAGAA
>probe:Drosophila_2:1631723_at:321:187; Interrogation_Position=1047; Antisense; AACAGTGGCGTTGTTCTGGATGCCT
>probe:Drosophila_2:1631723_at:714:371; Interrogation_Position=1097; Antisense; GAAGGTTCTCTCGAATTCTGGATTG
>probe:Drosophila_2:1631723_at:339:691; Interrogation_Position=1144; Antisense; TATTGGCCGATGTGCGGGACACGCT
>probe:Drosophila_2:1631723_at:714:397; Interrogation_Position=1161; Antisense; GACACGCTCGACCAGCATCGGGAAG
>probe:Drosophila_2:1631723_at:65:197; Interrogation_Position=1261; Antisense; AACTGGCTGGAGAATCTGCGCCGGC
>probe:Drosophila_2:1631723_at:409:317; Interrogation_Position=1280; Antisense; GCCGGCTACGTTTAGTCCACATATT
>probe:Drosophila_2:1631723_at:724:137; Interrogation_Position=1339; Antisense; ACGAGGAGATGATTGCCATGCTGCA
>probe:Drosophila_2:1631723_at:374:585; Interrogation_Position=1375; Antisense; TGGAGGATGGTACTGTATCGCAATC
>probe:Drosophila_2:1631723_at:123:43; Interrogation_Position=1391; Antisense; ATCGCAATCCAGTGTAAAATCCGTG
>probe:Drosophila_2:1631723_at:514:277; Interrogation_Position=947; Antisense; CTATCTACGAAAAAGGCATCTCCTG
>probe:Drosophila_2:1631723_at:94:367; Interrogation_Position=977; Antisense; GAATCATGAACGTCGCAGTCTTGCC
>probe:Drosophila_2:1631723_at:279:89; Interrogation_Position=993; Antisense; AGTCTTGCCCTGCACAACATCGAAT

Paste this into a BLAST search page for me
AACATCGAATCTCTTCTGTCCAGTGTGTCCAGTGTGGATGAGGCCCAGAAAACAGTGGCGTTGTTCTGGATGCCTGAAGGTTCTCTCGAATTCTGGATTGTATTGGCCGATGTGCGGGACACGCTGACACGCTCGACCAGCATCGGGAAGAACTGGCTGGAGAATCTGCGCCGGCGCCGGCTACGTTTAGTCCACATATTACGAGGAGATGATTGCCATGCTGCATGGAGGATGGTACTGTATCGCAATCATCGCAATCCAGTGTAAAATCCGTGCTATCTACGAAAAAGGCATCTCCTGGAATCATGAACGTCGCAGTCTTGCCAGTCTTGCCCTGCACAACATCGAAT

Full Affymetrix probeset data:

Annotations for 1631723_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720